yaaO

168

similar to arginine decarboxylase, affects the level of Efp modification

Locus: BSU_00270

Molecular weight: 53.00 kDa

Isoelectric point: 5.71

Protein length: 480 aa

Gene length: 1440 bp

Function: control of Efp modification

Product: putative arginine decarboxylase

Essential: no

E.C.: 4.1.1.19

Synonyms: yaaO

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1982 (Galperin et al., 2021)

Gene

Coordinates: 37,720 → 39,162

Phenotypes of a mutant

• inactivation suppresses the swarming defect of a ymfI mutant PubMed

The protein

Catalyzed reaction/ biological activity

• the protein was reported to be involved in norspermidine production and biofilm disassembly PubMed; however, this is not the case PubMed and the original paper has been retracted

Protein family

• Orn/Lys/Arg decarboxylase class-I family (together with SpeA) (according to UniProt)

Cofactors

• PLP (according to UniProt)

Structure

• 2X3L (PDB) (from Staphylococcus aureus, 36% identity) PubMed
• P37536 (AlphaFold)

Paralogous protein(s)

• SpeA

Expression and Regulation

Operons

• Genes: xpaC-yaaN-yaaO-tmk-darA-yaaR-holB-ricT-yabA-trmN6-yazA-yabC

  Description: PubMed

• Genes: xpaC-yaaN-yaaO

  Description: PubMed

  Regulation

  • expressed in stationary phase

  Sigma factors

  • SigW: sigma factor, PubMed, in sigW regulon
  • SigK: sigma factor, PubMed, in sigK regulon

Biological materials

Mutant

• GP3961 (ΔyaaO::kan), available in Jörg Stülke's lab
• GP3962 (ΔyaaO::phleo), available in Jörg Stülke's lab
• MGNA-B896 (yaaO::erm), available at the NBRP B. subtilis, Japan
• BKE00270 (ΔyaaO::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGAAAACAATCCTTTGAA,  downstream forward: _UP4_GTTTATATAGAAGAGGAGAA
• BKK00270 (ΔyaaO::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGAAAACAATCCTTTGAA,  downstream forward: _UP4_GTTTATATAGAAGAGGAGAA

Expression vectors

• pGP3751: IPTG inducible expression, purification in E. coli with N-terminal Strep-tag, in pGP172, available in Jörg Stülke's lab
• pGP3753: expression of Strep-yaaO by pGP380 in B. subtilis suitable for SPINE, available in Jörg Stülke's lab
• pGP3754: expression of yaaO-Strep by pGP382 in B. subtilis suitable for SPINE, available in Jörg Stülke's lab
• pGP3757 (N-terminal 6xHis-SUMO-tag, purification from E. coli, in pET-SUMO), available in Jörg Stülke's lab

References

Loading