speE

168

spermidine synthase, N¹-aminopropylagmatine synthase

Locus: BSU_37500

Molecular weight: 31.18 kDa

Isoelectric point: 5.07

Protein length: 276 aa

Gene length: 831 bp

Function: spermidine, polyamine biosynthesis

Product: spermidine synthase

Essential: no

E.C.: 2.5.1.16

Synonyms: speE, ywhF

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0421 (Galperin et al., 2021)

Gene

Coordinates: 3,848,786  3,849,616

Phenotypes of a mutant

• inactivation of speE reduces sporulation efficiency to 6% that of wild type cells; delayed entry into sporulation PubMed
• reduced survival after DNA replication arrest imposed by inhibition of PolC activity PubMed

The protein

Catalyzed reaction/ biological activity

• agmatine + S-adenosyl-L-methioninamine --> H⁺ + S-methyl-5'-thioadenosine + N¹-aminopropylagmatine PubMed

Protein family

• spermidine/spermine synthase family (single member, according to UniProt)

Domains

• PABS domain (aa 3-236) (according to UniProt)

Structure

• 1IY9 (PDB)
• P70998 (AlphaFold)

Expression and Regulation

Operons

• Genes: speE-speB

  Description: PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

Additional information

• Jörg Stülke's lab

Biological materials

Mutant

• MGNA-A521 (ywhF::erm), available at the NBRP B. subtilis, Japan
• BKE37500 (speE::erm ), available in the BGSC and in Jörg Stülke's lab) PubMed
• BKE37500 (speE::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAATTGTCATCTCCCTTTCG,  downstream forward: _UP4_TAATGAAGGTATGGCGCAGG
• BKK37500 (speE::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAATTGTCATCTCCCTTTCG,  downstream forward: _UP4_TAATGAAGGTATGGCGCAGG

Expression vectors

• pGP3758: expression of Strep-speE by pGP380 in B. subtilis suitable for SPINE, available in Jörg Stülke's lab
• pGP3759: expression of speE-Strep by pGP382 in B. subtilis suitable for SPINE, available in Jörg Stülke's lab

References

Loading