dprA

168

conveys incoming ssDNA to RecA; facilitates the displacement of both SSBs (SsbB and SsbA), increases RecA nucleation onto SSB-coated ssDNA, and mediates DNA strand annealing, required to internalize and to recombine ssDNA with homologous resident duplex, crucial for the RecA-dependent acquisition of homologous genes from related species by natural transformation

Locus: BSU_16110

Molecular weight: 32.78 kDa

Isoelectric point: 9.76

Protein length: 297 aa

Gene length: 894 bp

Function: DNA repair/ recombination

Product: recombination mediator protein

Essential: no

Synonyms: dprA, smf

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0758 (Galperin et al., 2021)

Gene

Coordinates: 1,682,580 → 1,683,473

Phenotypes of a mutant

• strongly impaired genetic recombination PubMed
• ''recO dprA'' double mutants have a strongly reduced chromosomal transformation rate PubMed
• loss of plasmid transformation PubMed

The protein

Catalyzed reaction/ biological activity

• binds ssDNA, promotes displacement of SsbA and SsbB from ssDNA PubMed
• provides RecA access to ssDNA during chromosomal transformation (together with RecO) PubMed
• RecA-ATP in concert with DprA and SsbA catalyzes DNA strand exchange, with SsbB as an accessory factor PubMed
• the SsbA-DprA mediator loads RecA onto any fragmented linear SPP1 ssDNA PubMed
• anneals SsbA- or SsbB-coated complementary strands of transfecting SPP1 phage DNA, yielding tailed SPP1 duplex intermediates PubMed
• DprA, RecO or viral single strand annealing G35P protein, may catalyze the annealing of complete linear phage genomes with redundant regions at the ends of the molecule, alone or with the help of an exonuclease, to produce a circular unit-length duplex viral genome ready to initiate replication PubMed

Protein family

• DprA/Smf family (single member, according to UniProt)

Structure

• 3UQZ (PDB) (aa 90 ... 310, from Streptococcus pneumoniae, 44% identity) PubMed
• P39813 (AlphaFold)

Localization

• transiently localizes to the cell pole, and co-localizes with the DNA uptake machinery PubMed

Expression and Regulation

Operons

• Genes: sucC-sucD-dprA-topA

  Description: PubMed

  Regulation

  • repressed by glucose (2.4-fold) (CcpA) PubMed
  • expression is heterogeneous PubMed

  Regulatory mechanism

  • CcpA: repression, PubMed, in ccpA regulon

Additional information

• expressed under conditions that trigger genetic competence (ComK) PubMed

Biological materials

Mutant

• BKE16110 (ΔdprA::erm  trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAATAGATTGACCTCCTTTT,  downstream forward: _UP4_TGAATTATCGTTTGACAAAC
• BKK16110 (ΔdprA::kan  trpC2) available at BGSC and in Jörg Stülke's lab, PubMed, upstream reverse: _UP1_CAATAGATTGACCTCCTTTT,  downstream forward: _UP4_TGAATTATCGTTTGACAAAC

Labs working on this gene/protein

• Peter Graumann, Freiburg University, Germany homepage

References

Reviews

Loading

Original Publications

Loading