sigL

168

sigma factor of the RNA polymerase, Sigma-54, Sigma L

Locus: BSU_34200

Molecular weight: 49.54 kDa

Isoelectric point: 7.79

Protein length: 436 aa

Gene length: 1311 bp

Function: utilization of arginin, acetoin and fructose, required for cold adaptation

Product: RNA polymerase sigma-54 factor (sigma-L)

Essential: no

Synonyms: sigL

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1508 (Galperin et al., 2021)

Gene

Coordinates: 3,512,498  3,513,808

Phenotypes of a mutant

• The mutant is cold-sensitive and unable to use arginine as a single carbon source PubMed

The protein

Catalyzed reaction/ biological activity

• Binding to promoters of the -12, -24 type

Protein family

• sigma-54 factor family (single member, according to UniProt)

Domains

• DNA binding domain (HTH motif) (324343)
• pron box domain (413421)
• 3 x Compositional bias domain (621),(3253),(112136)

Structure

• 5BYH (PDB) (E. coli RNA polymerase containing Sigma-54) PubMed
• P24219 (AlphaFold)

Additional information

• Transcription initiation by SigL-containing RNA polymerase requires the activity of ATP-hydrolyzing transcription activators
• information on binding sites can be found in the PRODORIC2 database

Expression and Regulation

Operons

• Genes: sigL

  Description: PubMed

  Regulation

  • repressed by glucose (CcpA) PubMed

  Regulatory mechanism

  • CcpA: repression, transcriptional roadblock PubMed, in ccpA regulon

Biological materials

Mutant

• GP146 (ΔsigL::spc), available in Jörg Stülke's lab PubMed
• GP2302 (ΔsigL::tet), available in Jörg Stülke's lab
• 1A914 (sigL::kan), PubMed, available at BGSC
• BKE34200 (ΔsigL::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCTTGCTCACTCCCCTTT,  downstream forward: _UP4_TAAAATCCTCCCTAGACGGG
• BKK34200 (ΔsigL::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATCTTGCTCACTCCCCTTT,  downstream forward: _UP4_TAAAATCCTCCCTAGACGGG

Expression vectors

• pGP3707: expression of Strep-sigL by pGP380 in B. subtilis suitable for SPINE, available in Jörg Stülke's lab
• pGP3714: IPTG inducible expression, purification in E. coli with N-terminal Strep-tag, in pGP172, available in Jörg Stülke's lab

FLAG-tag construct

• pGP3798 for the construction of sigL-3xFLAG spc (based on pGP1331), available in Jörg Stülke's lab

Labs working on this gene/protein

• Michel Debarbouille, Pasteur Institute, Paris, France Homepage

References

Reviews

Loading

Original Publications

Loading