sboX
168
bacteriocin-like product
locus
BSU_37360
Molecular weight
5.66 kDa
pI
9.86
function
unknown
product
bacteriocin-like product
essential
no
ec
null
synonyms
sboX
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms
This gene is a member of the following regulons
Gene
Coordinates
3,836,146 3,836,298
The protein
Structure
[AF|Q7WY57]
Expression and Regulation
Operons
genes
[gene|8CBBEC47A5CC3EAE73BE68E68417C5F2A4DA5C23|sboA]-[gene|83AAFAA187B4FCEE24B4EA2DD4935425A3B48DAA|sboX]-[gene|DEDA6F03386F360F6C0B2CC5F09DF3C9D85173F1|albA]-[gene|D399B25AE22ECB6C7ACDCFF4DCE4D9D908184E75|albB]-[gene|19CC58F5ABADAD45BA55D88BBD77B586AA5D85FE|albC]-[gene|DAD8308DF72E648610D1A12BC92063E1550CB1B4|albD]-[gene|A474F01AA4AD859963E39CD528BC42FF43A72433|albE]-[gene|D03FB4EAEFBC25A5B0459CF464BFADF1FC7620B2|albF]-[gene|55A34610EF7AA5E515DE3DCDA333ED3A42B0EF08|albG]
description
[Pubmed|10572140]
regulation
expressed under anaerobic conditions ([protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]) [Pubmed|10809710]
expression
expression is heterogeneous [pubmed|35171018]
regulatory mechanism
[protein|1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok]: repression, [Pubmed|15743949], in [regulon|protein:1508770D5BCA5739D13E3ABD11CC5C103C07FF25|rok regulon]
[protein|1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD]: activation, [Pubmed|10809710], in [regulon|protein:1E829D639BADDC6BDC9B5FB4C97A632A53FDDB24|resD regulon]
[protein|E5110D9C36E8C55AFD1419987B14A53232165F20|abrB]: repression, [PubMed|10572140,17720793], in [regulon|protein:E5110D9C36E8C55AFD1419987B14A53232165F20|abrB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10572140], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Biological materials
Mutant
BKE37360 ([gene|83AAFAA187B4FCEE24B4EA2DD4935425A3B48DAA|sboX]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE37360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGACTATGCCCTTTTGGGA, downstream forward: _UP4_TGAATCATATGTATAGGGGA
BKK37360 ([gene|83AAFAA187B4FCEE24B4EA2DD4935425A3B48DAA|sboX]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK37360 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATGACTATGCCCTTTTGGGA, downstream forward: _UP4_TGAATCATATGTATAGGGGA
References
Page visits: 4102
Time of last update: 2025-10-29 03:28:39
Author of last update: Bzhu