recO

168

mediator of RecA binding to ssDNA, required for the formation of RecA DNA repair centers, required for efficient survival and replication restart after replication-transcription conflicts

Locus: BSU_25280

Molecular weight: 29.20 kDa

Isoelectric point: 8.21

Protein length: 255 aa

Gene length: 768 bp

Function: DNA repair/ recombination

Product: mediator of RecA binding to ssDNA

Essential: no

Synonyms: recO, yqxN, yqfI

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1381 (Galperin et al., 2021)

Gene

Coordinates: 2,608,946  2,609,713

Phenotypes of a mutant

• strongly reduced survival after mitomycin treatment PubMed
• drastically reduced survival of mature dormant spores after exposure to ultrahigh vacuum desiccation and ionizing radiation that induce single strand (ss) DNA nicks and double-strand breaks (DSBs) PubMed
• ''recO recJ'' double mutants are extremely sensitive against DNA damaging agents PubMed
• ''recO dprA'' double mutants have a strongly reduced chromosomal transformation rate PubMed
• ''recO addA-addB'' double mutants are extremely sensitive against DNA damaging agents PubMed
• reduced viability of a rarA recO double mutant PubMed
• suppression of lethality of pcrA inactivation PubMed

The protein

Catalyzed reaction/ biological activity

• provides RecA access to ssDNA during chromosomal transformation (together with DprA) PubMed
• catalyzes annealing of SsbA or SsbA/SsbB coated ssDNAs to allow the formation of DNA duplexes with tails during plasmid transformation PubMed
• required for the formation of RecA DNA repair centers (together with RecR) PubMed
• anneals SsbA- or SsbB-coated complementary strands of transfecting SPP1 phage DNA, yielding tailed SPP1 duplex intermediates PubMed
• DprA, RecO or viral single strand annealing G35P protein, may catalyze the annealing of complete linear phage genomes with redundant regions at the ends of the molecule, alone or with the help of an exonuclease, to produce a circular unit-length duplex viral genome ready to initiate replication PubMed

Protein family

• recO family (single member, according to UniProt)

Structure

• 2V1C (PDB) (the RecR-RecO complex from Deinococcus radiodurans, RecR: 52% identity, 78% similarity, RecO: 30%/ 58%)  PubMed
• P42095 (AlphaFold)

Localization

• cytoplasm (according to Swiss-Prot)
• localizes to the DNA entry pole during transformation PubMed

Expression and Regulation

Operons

• Genes: cdd-era-yqzL-recO

  Description: PubMed

  Expression

  • expression is increased upon depletion of depletion of tRNA maturation factors rnpB or rnz PubMed

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon
  • SigB: sigma factor, PubMed, in sigB regulon

Biological materials

Mutant

• GP3527 (ΔrecO::kan), available in Jörg Stülke's lab
• MGNA-C494 (yqxN::erm), available at the NBRP B. subtilis, Japan
• 1A892 ( recO::cat), PubMed, available at BGSC
• BG128 (ΔrecO::cat), available in Juan Alonso's and Jörg Stülke's labs PubMed
• BP738 ( ΔrecO::tet), (available in Fabian Commichau's lab)
• BP774 ( ΔrecO::ermC), (available in Fabian Commichau's lab)
• BKE25280 (ΔrecO::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTCCGCACCTTCCTCAA,  downstream forward: _UP4_TGACATTTGGTCCATCTTTT
• BKK25280 (ΔrecO::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTCCGCACCTTCCTCAA,  downstream forward: _UP4_TGACATTTGGTCCATCTTTT

References

Reviews

Loading

Original Publications

Loading