pfeT

168

Fe²⁺ efflux pump, P_1B4-type ATPase, protects the cell against iron intoxication

Locus: BSU_13850

Molecular weight: 68.39 kDa

Isoelectric point: 4.93

Protein length: 637 aa

Gene length: 1914 bp

Function: protection against toxic iron

Product: Fe²⁺ efflux pump

Essential: no

E.C.: 3.6.3.5

Synonyms: pfeT, ykvW, zosA

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Transporters, Transporters/ other, Metal ion transporter

Metabolism, Additional metabolic pathways, Iron metabolism, Iron export

Groups of genes, Membrane proteins

List of homologs in different organisms, belongs to COG2217 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, Fur regulon, PerR regulon

Gene

Coordinates: 1,451,371  1,453,284

Phenotypes of a mutant

sensitivity to iron, this can be suppressed by low levels of Mn²⁺ PubMed
reduced genetic competence, can be rescued by the addition of excess zinc PubMed
reduced expression of comK, control is exerted at the post-transcriptional level and can be rescued by the addition of excess zinc  PubMed

The protein

Catalyzed reaction/ biological activity

ATP + H₂O + Zn²⁺ --> ADP + H⁺ + phosphate + Zn²⁺ (according to UniProt)
P-type zinc-transporting ATPase PubMed

Protein family

cation transport ATPase (P-type) (TC 3.A.3) family (according to UniProt)

Structure

4UMV (PDB) (zinc transporter from Shigella sonnei, 39% identity) PubMed
O31688 (AlphaFold)

Paralogous protein(s)

CadA, CopA

Localization

cell membrane (according to UniProt)

Expression and Regulation

Operons

Genes: pfeT

Description: PubMed

Regulation

induced by hydrogen peroxide (AhpC, PerR) PubMed
induced by iron excess (Fur) PubMed

Regulatory mechanism

PerR: repression, PubMed, in perR regulon
Fur: activation, PubMed, in fur regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Additional information

A ncRNA is predicted between 'StoA' and 'PfeT' PubMed

Biological materials

Mutant

MGNA-B329 (ykvW::erm), available at the NBRP B. subtilis, Japan
GP3357 (pfeT::phleo trpC2) available in Jörg Stülke's lab
BKE13850 (pfeT::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATCGAATTCTCCTCTCT,  downstream forward: _UP4_TAAAACCAGCAGCCTAATCA
BKK13850 (pfeT::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATCGAATTCTCCTCTCT,  downstream forward: _UP4_TAAAACCAGCAGCCTAATCA

References

Reviews

Loading

Original Publications

Loading