penP
168
beta-lactamase
locus
BSU_18800
Molecular weight
33.29 kDa
pI
9.21
function
resistance to beta-lactam antibiotics
product
beta-lactamase
essential
no
ec
3.5.2.6
synonyms
penP
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG2367 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
2,048,533 2,049,453
The protein
Catalyzed reaction/ biological activity
β-lactam + H2O --> substituted β-amino acid (according to UniProt)
Protein family
[wiki|beta-lactamase family] (according to UniProt)
class-A beta-lactamase family (single member, according to UniProt)
Structure
[PDB|6NI1]
[AF|P39824]
[wiki|Localization]
extracellular (signal peptide) [Pubmed|18957862]
Expression and Regulation
Operons
genes
[gene|713BAB7190E1F86C55103049B29072F00E0DFFB3|penP]
description
[Pubmed|22383849]
Biological materials
Mutant
BKE18800 ([gene|713BAB7190E1F86C55103049B29072F00E0DFFB3|penP]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE18800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGGCCTCCTCATTCAA, downstream forward: _UP4_TAATATGTTTAGCCTTTTGC
BKK18800 ([gene|713BAB7190E1F86C55103049B29072F00E0DFFB3|penP]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK18800 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCAGGCCTCCTCATTCAA, downstream forward: _UP4_TAATATGTTTAGCCTTTTGC
References
Page visits: 4723
Time of last update: 2025-10-20 18:46:08
Author of last update: Melvin.boenninger