pxpB
168
subunit of [metabolite|ATP]-dependent 5-oxoprolinase, inhibitor of [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|kinA], control of the [wiki|phosphorelay]
locus
BSU_04080
Molecular weight
26.57 kDa
pI
4.66
function
detoxification of [metabolite|5-oxoproline], control of the [wiki|phosphorelay], initiation of [wiki|sporulation]
product
subunit of 5-oxoprolinase, inhibitor of [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|kinA]
essential
no
synonyms
pxpB, kipI, ycsJ
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG2049 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
459,867 460,589
Phenotypes of a mutant
no growth with [metabolite|5-oxoproline] as single source of nitrogen [pubmed|28830929]
reduced growth with [metabolite|ammonium] as source of nitrogen due to the accumulation of toxic [metabolite|5-oxoproline] [pubmed|28830929]
The protein
Catalyzed reaction/ biological activity
[metabolite|5-oxoproline] + [metabolite|ATP] --> [metabolite|glutamate] + [metabolite|ADP] + Pi [pubmed|28830929]
Protein family
PxpB family (single member, according to UniProt)
Structure
[PDB|2ZP2] [Pubmed|18823995]
[AF|P60495]
Effectors of protein activity
binding of [protein|3BA8F1F71B1D65EB30867ABD27867F925DAD2D7B|pxpC] prevents [protein|5A5E17D39296FECC1C03B1A7791AB1065BB4E4DF|pxpB] from binding to [protein|B29CAD04FB89ACC482EFCD29D50EDDA19145CAA2|kinA] [Pubmed|9334321]
Kinetic information
Km ([metabolite|5-oxoproline]): 39 M [pubmed|28830929]
Expression and Regulation
Operons
genes
[gene|77F758CE9A59AC41F283CB1F5099097386133799|pxpA]-[gene|9AD419E3CB86C54A0F11E96C82E80A357C6B23D2|ycsG]-[gene|312E2A4ADFBCB9DD9AD9EEEC9FE53F3932AF5DBA|ycsI]-[gene|5A5E17D39296FECC1C03B1A7791AB1065BB4E4DF|pxpB]-[gene|3BA8F1F71B1D65EB30867ABD27867F925DAD2D7B|pxpC]-[gene|7DA9A79876C546B78B716A64706A3A3716018C2E|kipR]-[gene|05910B4500420D4DB75DAD3A7A2358C360FF2154|lipC]
description
[Pubmed|9334321]
regulation
induced in the presence of 5-oxoproline [pubmed|28830929]
regulatory mechanism
[protein|7DA9A79876C546B78B716A64706A3A3716018C2E|kipR]: repression, [Pubmed|9334321], in [regulon|protein:7DA9A79876C546B78B716A64706A3A3716018C2E|kipR regulon]
[protein|857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA]: activation, [Pubmed|9334321], in [regulon|protein:857EF1AC54DEA0690C01B7F8CEFFD16312C58F20|tnrA regulon]
Biological materials
Mutant
BKE04080 ([gene|5A5E17D39296FECC1C03B1A7791AB1065BB4E4DF|pxpB]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE04080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTCTCACCTCTTTTA, downstream forward: _UP4_TATAAGGAGGAGTCCAATTG
BKK04080 ([gene|5A5E17D39296FECC1C03B1A7791AB1065BB4E4DF|pxpB]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK04080 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATCTTTCTCACCTCTTTTA, downstream forward: _UP4_TATAAGGAGGAGTCCAATTG
References
Page visits: 7795
Time of last update: 2025-10-27 07:35:53
Author of last update: Jstuelk