gltT

168

major high-affinity Na⁺-coupled glutamate/ aspartate symport protein, uptake of glyphosate

Locus: BSU_10220

Molecular weight: 45.76 kDa

Isoelectric point: 9.03

Protein length: 429 aa

Gene length: 1290 bp

Function: glutamate and aspartate uptake

Product: major Na⁺-coupled glutamate/ aspartate symport protein

Essential: no

Synonyms: gltT, yhfG

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1301 (Galperin et al., 2021)

Gene

Coordinates: 1,096,560  1,097,849

Phenotypes of a mutant

• impaired uptake of glutamate and aspartate PubMed
• resistant to glyphosate PubMed

The protein

Catalyzed reaction/ biological activity

• uptake of glutamate and aspartate
• uptake of glyphosate and glufosinate PubMed

Protein family

• dicarboxylate/amino acid:cation symporter (DAACS) (TC 2.A.23) family (according to UniProt)

Structure

• 4IZM (PDB) (the protein from Pyrococcus horikoshii, 35% identity, 73% similarity) PubMed
• 4KY0 (the glutamate transporter of Thermococcus kodakarensis, 35% identity, 72% similarity) PubMed
• O07605 (AlphaFold)

Effectors of protein activity

• aspartate uptake is competitively inhibited by glutamate PubMed

Kinetic information

• Km values: 37 +/- 5 µM for glutamate, 41 +/- 9 µM for aspartate PubMed
• K_S for glutamate:
• - 300 nM (at external KCl concentration of 0.1 mM) PubMed
• - 60 nM (at external KCl concentration of 5 mM) PubMed

Paralogous protein(s)

• GltP, DctP

Localization

• cell membrane PubMed

Expression and Regulation

Operons

• Genes: gltT

  Description: PubMed

Biological materials

Mutant

• BP233 (ΔgltT::spc), available in Fabian Commichau's lab
• GP2825 (ΔgltP::cat ΔgltT::kan), available in Jörg Stülke's lab
• GP2247 (ΔgltT::ermC), available in Jörg Stülke's lab
• GP2248 (ΔgltT::aphA3), available in Jörg Stülke's lab
• GP2722 (ΔgltT::zeo), available in Jörg Stülke's lab
• GP4154 (ΔgltT::kan) (ΔyveA::cat), available in Jörg Stülke's lab
• BKE10220 (gltT::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAGATTACCTCCCAAAAA,  downstream forward: _UP4_TAATGAAAAGCCTGCGGGGT
• BKK10220 (gltT::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAGATTACCTCCCAAAAA,  downstream forward: _UP4_TAATGAAAAGCCTGCGGGGT
• GP2831 (ΔgltT::aphA3 ΔaimA::phleo), available in Jörg Stülke's lab

Expression vectors

• for expression in B. subtilis, in pAC7: pBP56,  available in Fabian Commichau's lab

FLAG-tag construct

• GP3063 gltT-3xFLAG spc (based on pGP1331), available in Jörg Stülke's lab

References

Loading