glnK
168
two-component sensor kinase, regulation of the [gene|1A415DC85354373EA4866733C3AE43F510BD3C56|glsA]-[gene|E371BC4F613C40CB0E8C8CAA97387F3E6735D813|glnT] operon
locus
BSU_02440
Molecular weight
44.00 kDa
pI
5.73
function
regulation of the [gene|1A415DC85354373EA4866733C3AE43F510BD3C56|glsA]-[gene|E371BC4F613C40CB0E8C8CAA97387F3E6735D813|glnT] operon
product
two-component sensor kinase
essential
no
synonyms
glnK, ycbA, yzgA
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG0642 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
265,476 → 266,708
The protein
Catalyzed reaction/ biological activity
autophosphorylation, phosphorylation of [protein|4E6EA2EABBDAA427E8F9EE1AE1800AF8657CF18B|glnL]
ATP + protein L-histidine --> ADP + protein N-phospho-L-histidine (according to UniProt)
[wiki|Domains]
four transmembrane segments
[wiki|Histidine kinase domain] (aa 189-405) (according to UniProt)
Structure
[AF|P40758]
Modification
autophosphorylation on a His residue
[wiki|Localization]
cell membrane (according to UniProt)
Expression and Regulation
Operons
genes
[gene|C18B886D06879C64B64606371E85A7D4D22DCFAC|glnK]-[gene|4E6EA2EABBDAA427E8F9EE1AE1800AF8657CF18B|glnL]
description
[pubmed|22383849]
Biological materials
Mutant
BKE02440 (Δ[gene|C18B886D06879C64B64606371E85A7D4D22DCFAC|glnK]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE02440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGGGCCAGTATATATC, downstream forward: _UP4_ATTCAGAAAGGGTGAACCAA
BKK02440 (Δ[gene|C18B886D06879C64B64606371E85A7D4D22DCFAC|glnK]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK02440 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGAGGGCCAGTATATATC, downstream forward: _UP4_ATTCAGAAAGGGTGAACCAA
References
Page visits: 4488
Time of last update: 2025-10-28 11:06:28
Author of last update: Melvin.boenninger