fisB

fisB
168

membrane fission protein, mediates membrane fission during sporulation

locus
BSU_32350
Molecular weight
27.76 kDa
pI
9.53
Protein length
Gene length
function
release of the forespore into the mother cell cytoplasm
product
membrane fission protein
essential
no
ec
null
synonyms
fisB, yunB

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG5875 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,322,463  3,323,227
Phenotypes of a mutant
reduced sporulation efficiency (12 - 15%) [Pubmed|23388828]
The protein
Catalyzed reaction/ biological activity
mediates membrane fission during [wiki|sporulation] [Pubmed|23388828]
binds cardiolipin [Pubmed|23388828]
Structure
[AF|O32131]
[wiki|Localization]
cell membrane [Pubmed|23388828]
forms dynamic foci which become immobilized at the site of membrane fission [Pubmed|34185788,23388828]
Expression and Regulation
Operons
genes
[gene|588A4131772691A0402AD56B49D5C55D8BD46DFF|fisB]
description
[Pubmed|12662922]
regulation
expressed early during sporulation in the mother cell ([protein|search|SigE]) [Pubmed|15699190,12662922]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|15699190,12662922], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
Open in new tab

[gene|588A4131772691A0402AD56B49D5C55D8BD46DFF|fisB]

2025-10-21 09:36:48

ghost

158

81aa45bdc7de7e118de92fcd4b378e78c8e1186e

B3F36E1D6103A1ACA0FB1B58D9A56E4BBC8DA359

Biological materials
Mutant
MGNA-A978 (yunB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/978 NBRP B. subtilis, Japan]
BKE32350 ([gene|588A4131772691A0402AD56B49D5C55D8BD46DFF|fisB]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE32350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGAAAATCCCCCCTTACA,  downstream forward: _UP4_TAAGCCGCCTGTTGAAGAGG
BKK32350 ([gene|588A4131772691A0402AD56B49D5C55D8BD46DFF|fisB]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK32350 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CAAGAAAATCCCCCCTTACA,  downstream forward: _UP4_TAAGCCGCCTGTTGAAGAGG
References
Reviews
23518060,35638784
Original Publications
12662922,15699190,23388828,34185788,36041438

588A4131772691A0402AD56B49D5C55D8BD46DFF

Page visits: 4201

Time of last update: 2025-10-26 23:05:32

Author of last update: Jstuelk