dtd

168

D-aminoacyl-tRNA deacylase

Locus: BSU_27590

Molecular weight: 14.35 kDa

Isoelectric point: 4.35

Protein length: 132 aa

Gene length: 399 bp

Function: prevention of misincorporation of D-amino acids into proteins

Product: D-aminoacyl-tRNA deacylase

Essential: no

Synonyms: dtd, yrvI

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1490 (Galperin et al., 2021)

Gene

Coordinates: 2,820,077  2,820,475

Phenotypes of a mutant

• D-amino acids are toxic PubMed
• due to a mutation, the protein is not expressed in standard strains such as 168 and NCIB3610 PubMed

The protein

Protein family

• DTD family (single member, according to UniProt)

Structure

• 2DBO (PDB) (from Aquifex aeolicus, 55% identity)
• O32042 (AlphaFold)

Additional information

• due to a mutation, the protein is not expressed in standard strains such as 168 and NCIB3610 PubMed

Expression and Regulation

Operons

• Genes: rel-dtd

  Description: PubMed

Biological materials

Mutant

• MGNA-A825 (yrvI::erm), available at the NBRP B. subtilis, Japan
• BKE27590 (dtd::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACTGTAACGCTTGCTTCTG,  downstream forward: _UP4_TAAAAAAAGCTGCCAAAAGG
• BKK27590 (dtd::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACTGTAACGCTTGCTTCTG,  downstream forward: _UP4_TAAAAAAAGCTGCCAAAAGG

References

Loading