dra

dra
168

deoxyribose-phosphate aldolase

locus
BSU_39420
Molecular weight
22.06 kDa
pI
4.93
Protein length
Gene length
function
utilization of nucleotides as carbon source
product
deoxyribose-phosphate aldolase
essential
no
ec
4.1.2.4
synonyms
dra, deoC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0274 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
4,051,602  4,052,273
The protein
Catalyzed reaction/ biological activity
2-deoxy-D-ribose 5-phosphate --> acetaldehyde + D-glyceraldehyde 3-phosphate (according to UniProt)
Protein family
DeoC/FbaB aldolase family (single member, according to UniProt)
Structure
[PDB|1MZH] (from ''Aquifex aeolicus'', 42% identity, 62% similarity)
[AF|P39121]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|81CD1F97E887549F7FB742FCEF38B86B84383F5D|dra]-[gene|4F718681A7AD0C86B2551248570F493AC0B2E7E9|nupC]-[gene|D2EB7BBAC8817912DAC4E215879F5A4E2C47ECAF|pdp]
description
[Pubmed|8550462]
regulation
induced by deoxynucleotides ([protein|search|DeoR]) [Pubmed|8550462]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [Pubmed|10666464], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|E9C4C569F18B3335DA9C7FB5B17C87D661E62669|deoR]: repression, [Pubmed|8550462], in [regulon|protein:E9C4C569F18B3335DA9C7FB5B17C87D661E62669|deoR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8550462], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|81CD1F97E887549F7FB742FCEF38B86B84383F5D|dra]→[gene|D2EB7BBAC8817912DAC4E215879F5A4E2C47ECAF|pdp]

2025-10-19 07:37:05

ghost

126

b24eb750b98d8d0cd62de8826e0fdd903ded3523

FF2BA988E6DC720FC1826E0AE14DD57A6A640267

Biological materials
Mutant
BKE39420 ([gene|81CD1F97E887549F7FB742FCEF38B86B84383F5D|dra]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE39420 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCTTCGCACACTTCCTT,  downstream forward: _UP4_TAAGAGCTGACGGAAGGCAG
BKK39420 ([gene|81CD1F97E887549F7FB742FCEF38B86B84383F5D|dra]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK39420 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATCCTTCGCACACTTCCTT,  downstream forward: _UP4_TAAGAGCTGACGGAAGGCAG
References
10666464,11065368,8550462,10074062

81CD1F97E887549F7FB742FCEF38B86B84383F5D

Page visits: 4803

Time of last update: 2025-10-25 20:18:22

Author of last update: Melvin.boenninger