cysI

168

sulfite reductase (NADPH₂) (beta subunit)

Locus: BSU_33430

Molecular weight: 64.63 kDa

Isoelectric point: 5.49

Protein length: 571 aa

Gene length: 1716 bp

Function: sulfite reduction

Product: sulfite reductase (NADPH₂)

Essential: no

Synonyms: cysI, yvgR

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Metabolism, Additional metabolic pathways, Sulfur metabolism

Metabolism, Additional metabolic pathways, Sulfur metabolism, sulfur metabolism/ general

List of homologs in different organisms, belongs to COG0155 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, CysL regulon

Gene

Coordinates: 3,430,598  3,432,313

Phenotypes of a mutant

unable to grow with sulfate or sulfite as the only sulfur source PubMed

The protein

Catalyzed reaction/ biological activity

3 H₂O + hydrogen sulfide + 3 NADP⁺ --> 4 H⁺ + 3 NADPH + sulfite (according to UniProt)

Protein family

nitrite and sulfite reductase 4Fe-4S domain family (with NasD, according to UniProt)

Cofactors

Fe-S cluster PubMed
heme PubMed

Structure

6C3M (PDB) (from E. coli, 52% identity) PubMed
O32213 (AlphaFold)

Expression and Regulation

Operons

Genes: cysI-cysJ

Description: PubMed

Regulation

induced by sulfite, sulfate, and thiosulfate (CysL) PubMed

Regulatory mechanism

CysL: activation, PubMed, in cysL regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

MGNA-B602 (yvgR::erm), available at the NBRP B. subtilis, Japan
1A802 ( cysI::kan), PubMed, available at BGSC
1A934 ( cysI::kan), PubMed, available at BGSC
BKE33430 (''cysI::erm'', available in the BGSC, in Fabian Commichau's, and in Jörg Stülke's lab) PubMed
BKE33430 (cysI::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTTGAAAAACTCCTTTC,  downstream forward: _UP4_TGAGAAAGAAAGACGAGAGA
BKK33430 (cysI::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGTTGAAAAACTCCTTTC,  downstream forward: _UP4_TGAGAAAGAAAGACGAGAGA

References

Loading