citG

168

fumarase

Locus: BSU_33040

Molecular weight: 50.36 kDa

Isoelectric point: 5.47

Protein length: 462 aa

Gene length: 1389 bp

Function: TCA cycle

Product: fumarate hydratase

Essential: no

E.C.: 4.2.1.2

Synonyms: citG, fumC

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0114 (Galperin et al., 2021)

Gene

Coordinates: 3,389,024 3,390,412

Phenotypes of a mutant

• arginine is toxic for the mutant, this can be bypassed by inactivation of rocC encoding the major arginine transporter PubMed

The protein

Catalyzed reaction/ biological activity

• (S)-malate --> fumarate + H₂O (according to UniProt)

Protein family

• class-II fumarase/aspartase family (with AnsB, according to UniProt)

Structure

• 1FUO (PDB) (from E. coli, 64% identity) PubMed
• P07343 (AlphaFold)

Paralogous protein(s)

• AnsB

Localization

• forms discrete foci in the cytoplasm PubMed
• colocalizes with DNA upon DNA damage (MMS treatment) PubMed

Additional information

• belongs to the 100 most abundant proteins PubMed

Expression and Regulation

Operons

• Genes: citG

  Description: PubMed

  Regulation

  • constitutive

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon
  • SigH: sigma factor, PubMed, in sigH regulon

• Genes: yvzF-citG

  Description: PubMed

Biological materials

Mutant

• GP718 (spec), available in Jrg Stlke's lab PubMed
• GP2340 ''citG::kan, Cre-recombinase is integrated in sacA'', available in Jrg Stlke's lab
• GP2341 ''citG::lox72, Cre-recombinase is integrated in sacA'', available in Jrg Stlke's lab
• BKE33040 (citG::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTATGTATCCCTCCATA, downstream forward: _UP4_TAATAGGAAGAACGGCTGCT
• BKK33040 (citG::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTATGTATCCCTCCATA, downstream forward: _UP4_TAATAGGAAGAACGGCTGCT

Expression vectors

• pGP1122 (N-terminal Strep-tag, for SPINE, purification from B. subtilis, in pGP380) (available in Jrg Stlke's lab) PubMed
• pGP3706: IPTG inducible expression, purification in E. coli with N-terminal Strep-tag, in pGP172, available in Jörg Stülke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jrg Stlke's lab

FLAG-tag construct

• GP1132 (spc, based on pGP1331), available in Jrg Stlke's lab

LacZ fusion

• pGP387 (in pAC7), available in Jrg Stlke's lab

Antibody

• **

GFP fusion

• GP1433 (spc, based on pGP1870), available in the Jrg Stlke lab

References

Loading