cggR

168

repressor of the glycolytic gapA operon, DeoR family

Locus: BSU_33950

Molecular weight: 37.23 kDa

Isoelectric point: 5.68

Protein length: 340 aa

Gene length: 1023 bp

Function: transcriptional regulator

Product: central glycolytic genes regulator

Essential: no

Synonyms: cggR, yvbQ

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG2390 (Galperin et al., 2021)

Gene

Coordinates: 3,482,752  3,483,774

Phenotypes of a mutant

• suppresses the growth defect of glmR mutants on gluconeogenic substrates PubMed

The protein

Catalyzed reaction/ biological activity

• transcription repression of the glycolytic ''gapA'' operon

Protein family

• SorC transcriptional regulatory family (with DeoR, according to UniProt)

Domains

• DNA binding domain (H-T-H motif) (3756)

Structure

• 8R3G (PDB) (complex with gapA operon operator DNA) PubMed
• 3BXH (PDB) (in complex with fructose-6-P) PubMed
• 2OKG (PDB) (effector binding domain) PubMed
• 7OYK (PDB) (complex of the DNA-binding domain with the operator DNA) PubMed
• O32253 (AlphaFold)

Effectors of protein activity

• fructose-1,6-bisphosphate PubMed and dihydroxyacetone-P PubMed, glucose-6-P and fructose-6-P PubMed act as inducer and result in release of CggR from the DNA

Localization

• cytoplasma PubMed

Expression and Regulation

Operons

• Genes: cggR-gapA-pgk-tpi-pgm-eno

  Description: PubMed

  Regulation

  • expression induced by glycolytic intermediates (CggR) CggR PubMed
  • the mRNA is processed between cggR and gapA by RNase Y, this requires the RicA-RicF-RicT complex PubMed

  Regulatory mechanism

  • CggR: repression, PubMed, in cggR regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

• Genes: cggR-gapA

  Description: PubMed

  Regulation

  • expression induced by glucose (10 fold) (CggR) PubMed
  • the mRNA is processed between cggR and gapA by RNase Y, this requires the RicA-RicF-RicT complex PubMed

  Regulatory mechanism

  • CggR: repression, PubMed, in cggR regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

Additional information

• the mRNA is cleaved by RNase III PubMed

Biological materials

Mutant

• MGNA-A463 (yvbQ::erm), available at the NBRP B. subtilis, Japan
• GP311 (in frame deletion), available in Jörg Stülke's lab
• SM-NB7 (cggR-spc), available in Anne Galinier's and Boris Görke's labs
• BKE33950 (cggR::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGACTCAAACGTTCCTTC,  downstream forward: _UP4_TAATCCCTCAATATAAATAT
• BKK33950 (cggR::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGACTCAAACGTTCCTTC,  downstream forward: _UP4_TAATCCCTCAATATAAATAT

Expression vectors

• pGP705 (N-terminal His-tag, in pWH844), available in Jörg Stülke's lab

LacZ fusion

• pGP504 (in pAC7), pGP509 (in pAC6), available in Jörg Stülke's lab

Antibody

• available in Jörg Stülke's lab

Labs working on this gene/protein

• Stephane Aymerich, Microbiology and Molecular Genetics, INRA Paris-Grignon, France

References

Reviews

Loading

Original Publications

Loading