cdaA

168

diadenylate cyclase, synthesis of c-di-AMP in vegetative cells

Locus: BSU_01750

Molecular weight: 30.42 kDa

Isoelectric point: 8.07

Protein length: 273 aa

Gene length: 822 bp

Function: synthesis of c-di-AMP

Product: diadenylate cyclase

Essential: no

E.C.: 2.7.7.85

Synonyms: cdaA, ybbP, ybbQ

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1624 (Galperin et al., 2021)

Gene

Coordinates: 196,213 → 197,034

Phenotypes of a mutant

• inactivation of ''cdaA'' results in severe beta-lactam sensitivity PubMed
• a cdaA disA double mutant or cdaA cdaS disA triple mutant is not viable on complex medium; however, the mutant grows at low potassium concentration (0.1 mM) PubMed
• increased spontaneous mutagenesis PubMed

The protein

Catalyzed reaction/ biological activity

• synthesis of c-di-AMP from two molecules of ATP PubMed
• 2 ATP --> c-di-AMP + 2 diphosphate (according to UniProt)

Protein family

• adenylate cyclase family (with CdaS, according to UniProt)

Domains

• contains a DAC domain involved in the synthesis of c-di-AMP PubMed
• DAC domain (aa 82-242) (according to UniProt)

Cofactors

• Mn²⁺ PubMed

Structure

• 8OGM (PDB) (the DAC domain) PubMed
• 7OLH (PDB), 7OJS (PDB) (complex of the CdaA DAC domain and GlmM)
• 4RV7 (PDB) (the DAC domain and C-terminal domain of CdaA from Listeria monocytogenes (aa 101 - 273), 65% identity) PubMed
• 6HVL (PDB) (the DAC domain and C-terminal domain of CdaA from Listeria monocytogenes (aa 101 - 273) in complex with c-di-AMP, 65% identity) PubMed
• Q45589 (AlphaFold)

Effectors of protein activity

• the interaction with CdaR controls the diadenylate cyclase activity of CdaA PubMed
• the interaction with CdaR inhibits the diadenylate cyclase activity of CdaA (shown in S. aureus) PubMed
• the interaction with GlmM inhibits the diadenylate cyclase activity of CdaA (PubMed) under conditions of osmotic stress (shown in L. monocytogenes) PubMed

Paralogous protein(s)

• CdaS

Localization

• cell membrane PubMed

Expression and Regulation

Operons

• Genes: cdaA-cdaR-glmM-glmS

  Description: PubMed

  Regulatory mechanism

  • GlmS ribozyme: RNA switch, in GlmS ribozyme

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

Additional information

• CdaA levels are increased at increased potassium concentrations PubMed
• the mRNA is very stable (> 15 min) PubMed

Biological materials

Mutant

• GP94 ΔcdaA::spec, available in Jörg Stülke's lab PubMed
• GP997 ΔcdaA::cat, available in Jörg Stülke's lab PubMed
• GP2790 ΔcdaA::aphA3, available in Jörg Stülke's lab
• GP985 ΔcdaA-cdaR::cat, available in Jörg Stülke's lab PubMed
• GP2222 cdaA::cat cdaS::ermC ''disA::tet'', available in Jörg Stülke's lab, the mutant is only viable on minimal medium at low potassium concentration PubMed
• BKE01750 (ΔcdaA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTCCTCGTCCTCCAAGA,  downstream forward: _UP4_CGCTGGTATTGGAGGGGCAA
• BKK01750 (ΔcdaA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTCCTCGTCCTCCAAGA,  downstream forward: _UP4_CGCTGGTATTGGAGGGGCAA

Expression vectors

• expression of native cdaA in B. subtilis: pGP1960 (in pBQ200), available in Jörg Stülke's lab
• expression of cdaA-Strep in B. subtilis suitable for SPINE: pGP1986 (in pGP382), available in Jörg Stülke's lab
• IPTG inducible expression of cdaA-Strep in E. coli: pGP2564 (in pGP574), available in Jörg Stülke's lab
• IPTG inducible expression of His-cdaA in E. coli: pGP1970 (in pET19B), available in Jörg Stülke's lab PubMed

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab. Respective plasmid: pGP1990 PubMed

FLAG-tag construct

• GP1381 cdaA-3xFLAG ermC (based on pGP1087), available in Jörg Stülke's lab PubMed

LacZ fusion

• GP1339 (cat) based on pAC6, available in Jörg Stülke's lab PubMed

Labs working on this gene/protein

• Jörg Stülke, University of Göttingen, Germany Homepage

References

Reviews

Loading

Original Publications

Loading