brnQ

168

branched-chain amino acid transporter

Locus: BSU_26690

Molecular weight: 46.84 kDa

Isoelectric point: 9.78

Protein length: 440 aa

Gene length: 1323 bp

Function: uptake of valine and isoleucine

Product: branched-chain amino acid transporter

Essential: no

Synonyms: brnQ, yrdJ

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1114 (Galperin et al., 2021)

Gene

Coordinates: 2,727,160  2,728,482

Phenotypes of a mutant

• no phenotype for the single mutant, the triple bcaP brnQ braB mutant is strongly impaired in the transport of isoleucine and valine at low concentrations PubMed

The protein

Catalyzed reaction/ biological activity

• high affinity uptake of isoleucine and valine PubMed

Protein family

• branched chain amino acid transporter family (together with BraB) (according to UniProt)

Structure

• P94499 (AlphaFold)

Paralogous protein(s)

• BraB

Expression and Regulation

Operons

• Genes: azlB-azlC-azlD-brnQ-yrdK

  Description: PubMed

  Regulation

  • repressed by AzlB PubMed

  Regulatory mechanism

  • AzlB: repression, PubMed, in azlB regulon

Biological materials

Mutant

• GP4747 (trpC2 ΔbrnQ::neo), available in Jörg Stülke's lab
• GP4762 (trpC2 ΔbrnQ::lox72), available in Jörg Stülke's lab
• BKE26690 (brnQ::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTATATATCCTCCGATTA,  downstream forward: _UP4_ATTCCAGCTATTGCAGGAGG
• BKK26690 (brnQ::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTATATATCCTCCGATTA,  downstream forward: _UP4_ATTCCAGCTATTGCAGGAGG

References

Loading