addA

168

ATP-dependent deoxyribonuclease (subunit A), required for efficient survival and replication restart after replication-transcription conflicts, responsible for end resection during dsDNA break repair

Locus: BSU_10630

Molecular weight: 140.85 kDa

Isoelectric point: 5.13

Protein length: 1232 aa

Gene length: 3699 bp

Function: DNA repair/ recombination

Product: ATP-dependent deoxyribonuclease (subunit A))

Essential: no

Synonyms: addA, recE5

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1074 (Galperin et al., 2021)

Gene

Coordinates: 1,139,807  1,143,505

Phenotypes of a mutant

• reduced survival after mitomycin treatment PubMed
• recO addA-addB double mutants are extremely sensitive against DNA damaging agents PubMed
• reduced survival after DNA replication arrest imposed by inhibition of PolC activity PubMed

The protein

Catalyzed reaction/ biological activity

• the enzyme is functional as a heterodimer of the AddA and AddB subunits, that it is a rapid and processive DNA helicase, and that it catalyses DNA unwinding using one single-stranded DNA motor of 3'5' polarity located in the AddA subunit PubMed
• the AddB subunit contains a second putative ATP-binding pocket, but this does not contribute to the observed helicase activity and may instead be involved in the recognition of recombination hotspot sequences PubMed
• ATP + H₂O --> ADP + H⁺ + phosphate (according to UniProt)

Protein family

• helicase family (according to UniProt)

Domains

• UvrD-like helicase ATP-binding domain(aa 9-481) (according to UniProt)
• UvrD-like helicase C-terminal domain (aa 508-798) (according to UniProt)

Structure

• 3U4Q (PDB) (the AddA-AddB-DNA complex) PubMed
• P23478 (AlphaFold)

Expression and Regulation

Operons

• Genes: addB-addA-sbcD-sbcC-hlpB

  Description: PubMed

  Regulation

  • positive control by ComK PubMed

  Regulatory mechanism

  • ComK: activation, in comK regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

• GP1106 (addA-addB, spc), available in Jörg Stülke's lab PubMed
• BKE10630 (addA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_ATCTGTCCATGTGCTGTCTG,  downstream forward: _UP4_TAGCGAGATCCATAAGCTCC
• BKK10630 (addA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_ATCTGTCCATGTGCTGTCTG,  downstream forward: _UP4_TAGCGAGATCCATAAGCTCC

Labs working on this gene/protein

• Mark Dillingham, Bristol, U.K. (homepage)

References

Reviews

Loading

Original Publications

Loading