rsbR

168

stressosome sensor protein, control of SigB activity

Locus: BSU_04670

Molecular weight: 30.90 kDa

Isoelectric point: 4.73

Protein length: 274 aa

Gene length: 825 bp

Function: control of SigB activity

Product: activator of RsbT kinase activity, stressosome sensor protein

Essential: no

Synonyms: rsbR, ycxR, rsbRA

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1366 (Galperin et al., 2021)

Gene

Coordinates: 519,408 520,232

Phenotypes of a mutant

• the mutant tends to acquire suppressor mutations that result in improved growth PubMed

The protein

Catalyzed reaction/ biological activity

• positive regulator of YtvA-dependent light activation of the SigB stress response PubMed
• phosphorylated RsbR activates the kinase activity of RsbT PubMed

Domains

• RsbRA is composed of an N-terminal nonheme globin domain and a highly conserved C-terminal STAS (Sulphate Transporter and AntiSigma factor antagonist) domain. The C-terminal STAS domain is the target of the serine/threonine-specific kinase RsbT (see below).
• STAS domain (aa 150-265) (according to UniProt)

Structure

• 2BNL (PDB) (N-terminal domain), 3VY9 (PDB) (complete stressosome)
• P42409 (AlphaFold)

Modification

• phosphorylation on Thr-171 and Thr-205 by RsbT PubMed

Paralogous protein(s)

• YtvA, RsbRD, RsbRB, RsbRC

Additional information

• belongs to the 100 most abundant proteins PubMed

Expression and Regulation

Operons

• Genes: rsbR-rsbS-rsbT-rsbU-rsbV-rsbW-sigB-rsbX

  Description: PubMed

  Regulation

  • ''rsbV:'' induced by stress (SigB) PubMed

  Regulatory mechanism

  • CcpA: repression, PubMed, in ccpA regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon
  • SigB: sigma factor, PubMed, in sigB regulon

Biological materials

Mutant

• BKE04670 (rsbR::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAATTCGCTTACCTCCCAA, downstream forward: _UP4_ATCGTTTCATTGGGGGAATA
• BKK04670 (rsbR::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CAAATTCGCTTACCTCCCAA, downstream forward: _UP4_ATCGTTTCATTGGGGGAATA

Labs working on this gene/protein

• Bill Haldenwang, San Antonio, USA
• Chet Price, Davis, USA homepage
• Rick Lewis, Newcastle, UK homepage

References

Reviews

Loading

Original Publications

Loading