bacA

168

bacilysin biosynthesis protein, prephenate decarboxylase

Locus: BSU_37740

Molecular weight: 23.18 kDa

Isoelectric point: 7.9

Protein length: 204 aa

Gene length: 615 bp

Function: biosynthesis of the antibiotic bacilysin

Product: anticapsin biosynthesis protein, prephenate decarboxylase

Essential: no

E.C.: null

Synonyms: bacA, ywfB, ipa-80d

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0077 (Galperin et al., 2021)

Gene

Coordinates: 3,873,566  3,874,180

Phenotypes of a mutant

• defective in sporulation timing PubMed

The protein

Catalyzed reaction/ biological activity

• decarboxylation of prephenate PubMed
• H⁺ + prephenate --> 3-[(4R)-4-hydroxycyclohexa-1,5-dien-1-yl]-2-oxopropanoate + CO₂ (according to UniProt)

Protein family

• prephenate decarboxylase family (single member, according to UniProt)

Structure

• P39638 (AlphaFold)

Expression and Regulation

Operons

• Genes: bacA-bacB-bacC-bacD-bacE-bacF

  Description: PubMed

  Regulation

  • heterogeneous expression, percentage of expressing cells increases during colonization of plant roots PubMed

  Regulatory mechanism

  • CodY: repression, PubMed, in codY regulon
  • AbrB: repression, PubMed, in abrB regulon
  • ScoC: repression, PubMed, in scoC regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

• MGNA-B239 (ywfB::erm), available at the NBRP B. subtilis, Japan
• BKE37740 (bacA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGAGCACCAACCAATCTT,  downstream forward: _UP4_TTATTTGGAAAAGGAGACGT
• BKK37740 (bacA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGAGCACCAACCAATCTT,  downstream forward: _UP4_TTATTTGGAAAAGGAGACGT

References

Loading