hepT
168
heptaprenyl diphosphate synthase component II
locus
BSU_22740
Molecular weight
39.36 kDa
pI
6.28
function
menaquinone biosynthesis
product
heptaprenyl diphosphate synthase component II (together with [protein|C45A5935559F0DAAD70F808725AF730BC18A2B0A|hepS])
essential
no
ec
2.5.1.30
synonyms
hepT, gerCC, hepB, gerC58
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG0142 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
2,381,919 2,382,965
Phenotypes of a mutant
essential [Pubmed|12682299], non-essential according to [Pubmed|28189581]
The protein
Catalyzed reaction/ biological activity
(2E,6E)-farnesyl diphosphate + 4 isopentenyl diphosphate --> all-trans-heptaprenyl diphosphate + 4 diphosphate (according to UniProt)
Protein family
FPP/GGPP synthase family (with [protein|C75A4465688BCE9902F9CDC6DE069E36667377E1|yqiD], according to UniProt)
Structure
[PDB|5H9D] (from Staphylococcus aureus, 47% identity) [pubmed|27457559]
[AF|P31114]
Paralogous protein(s)
[protein|C75A4465688BCE9902F9CDC6DE069E36667377E1|yqiD]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|C45A5935559F0DAAD70F808725AF730BC18A2B0A|hepS]-[gene|DDD40AEBBCBD3C19661A72B85912E266DBF267B3|menH]-[gene|3CAEA54E80A0B56EE120B881C8CDBE055AF6BDC1|hepT]-[gene|B498ED03F19B7A73878D5C947C28C2A87CAB934D|ndk]
description
[pubmed|22383849]
Biological materials
Mutant
BKE22740 ([gene|3CAEA54E80A0B56EE120B881C8CDBE055AF6BDC1|hepT]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE22740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCATTCACCCAAACATCTG, downstream forward: _UP4_TAATTTTTGTAGATATTAAG
BKK22740 ([gene|3CAEA54E80A0B56EE120B881C8CDBE055AF6BDC1|hepT]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK22740 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCATTCACCCAAACATCTG, downstream forward: _UP4_TAATTTTTGTAGATATTAAG
References
Page visits: 7582
Time of last update: 2025-10-26 01:51:50
Author of last update: Jstuelk