ywbI
168
transcriptional regulator ([wiki|LysR family]), activator of the [gene|7DA08C189F5524D4874E2F4828264AB2671A5460|ywbH]-[gene|2940E73F0BCAB69992BBD224402C95C2667757AD|ywbG] operon
locus
BSU_38310
Molecular weight
34.52 kDa
pI
5.93
function
control of expression of the [gene|7DA08C189F5524D4874E2F4828264AB2671A5460|ywbH]-[gene|2940E73F0BCAB69992BBD224402C95C2667757AD|ywbG] operon
product
transcriptional regulator ([wiki|LysR family])
essential
no
synonyms
ywbI, ipa-24d
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG0583 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
3,932,198 → 3,933,103
The protein
Protein family
[wiki|LysR family] (according to UniProt)
[wiki|Domains]
[wiki|HTH lysR-type domain] (aa 1-58) (according to UniProt)
Structure
[PDB|3FZV] (from Pseudomonas aeruginosa, 28% identity)
[AF|P39592]
Effectors of protein activity
acetate activates [protein|CC55120C2AF455FA2AEAE39E21F57897B2B5BC39|ywbI] to bind DNA [Pubmed|26060272]
Expression and Regulation
Operons
genes
[gene|CC55120C2AF455FA2AEAE39E21F57897B2B5BC39|ywbI]-[gene|9B82059498F72A67282DD54892EF02A305E3C674|thiM]-[gene|8FAEB6342E087BEDC16FDF5585B03B90ACFF8D11|thiE]
description
[Pubmed|9139923]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9139923], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Biological materials
Mutant
MGNA-B675 (ywbI::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1674 NBRP B. subtilis, Japan]
BKE38310 (Δ[gene|CC55120C2AF455FA2AEAE39E21F57897B2B5BC39|ywbI]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE38310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGCTTCACCCTTTCTA, downstream forward: _UP4_AAAGATAGTAAAGGATGATG
BKK38310 (Δ[gene|CC55120C2AF455FA2AEAE39E21F57897B2B5BC39|ywbI]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK38310 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCGCTTCACCCTTTCTA, downstream forward: _UP4_AAAGATAGTAAAGGATGATG
References
Page visits: 3388
Time of last update: 2025-10-27 15:28:47
Author of last update: Melvin.boenninger