swrA

swrA
168

master activator of flagellar biosynthesis, modulator of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU] activity, converts [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]-P from a repressor to an activator of the fla-che operon, enhances [gene|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD] transcription, controls the number of flagellar basal bodies, inactive pseudogene in strain 168

locus
BSU_35230
Protein length
Gene length
function
control of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU] activity
product
swarming motility protein
essential
no
synonyms
swrA, swrAA\/1, swrAA, yvzD, ifm

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms

This gene is a member of the following regulons

Gene
Coordinates
3,621,618  3,621,956
Phenotypes of a mutant
loss of [category|SW.4.1.4|Swarming] motility [Pubmed|12864845,35638827]
additional information
in the laboratory strain 168, the [gene|5D479874B43F521DB52EDC2C27CDE4967F22DE47|swrA] gene contains a frameshift mutation (insertion of an extra A in a stretch of eight As), thus the gene is annotated as [gene|0CEE58D799AF41634D161DBDF3D67EEFFF1C861E|swrAA/2] (corresponds to the small N-terminal part of the protein) and [gene|5D479874B43F521DB52EDC2C27CDE4967F22DE47|swrA] (corresponds to the large C-terminal part of the protein) [pubmed|15066026]
the mutation readily reverts giving rise to swarming behaviour [pubmed|15066026]
the [gene|5D479874B43F521DB52EDC2C27CDE4967F22DE47|swrA] gene is intact in wild type strains such as NCIB3610 [pubmed|15066026]
The protein
Catalyzed reaction/ biological activity
interacts with the N-terminal domain of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU] to control the activity of [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU] [Pubmed|22496484]
Structure
[AF|O32266]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|5D479874B43F521DB52EDC2C27CDE4967F22DE47|swrA]-[gene|0CEE58D799AF41634D161DBDF3D67EEFFF1C861E|swrAA/2]
description
[pubmed|22383849]
regulatory mechanism
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: activation, [protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]-P, ([protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA] promoter) [Pubmed|18567663], in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
sigma factors
[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]: sigma factor, [Pubmed|18567663], in [regulon|protein:7024E4162A6D827069F882FDEACA696EBC05DD40|sigD regulon]
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|18567663], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
additional information
SwrA levels are 3 ... 10-fold increased on solid medium as compared to liquid medium (due to [protein|FF15BE26BCC78EC1301C58A51AF0A519D7BE9ADC|lonA]/[protein|A6E7212D159F076F5D26F9C02F340B40C3667623|smiA]-mediated degradation of SwrA in liquid medium) [PubMed|25538299]
Open in new tab

[gene|5D479874B43F521DB52EDC2C27CDE4967F22DE47|swrA]->[gene|0CEE58D799AF41634D161DBDF3D67EEFFF1C861E|swrAA/2]

2025-10-24 21:50:14

Bzhu

147

1d66a859582759942c3e9a5ea6367e075254ef11

DD81E6238D869E3650C874663FCF4DB659D31F5D

Biological materials
Mutant
MGNA-A376 (yvzD::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/376 NBRP B. subtilis, Japan]
BKE35230 ([gene|5D479874B43F521DB52EDC2C27CDE4967F22DE47|swrA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE35230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCTGTCTTTTAATTGTTCCA,  downstream forward: _UP4_TAAACTCTCCTGAGGATATC
BKK35230 ([gene|5D479874B43F521DB52EDC2C27CDE4967F22DE47|swrA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK35230 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCTGTCTTTTAATTGTTCCA,  downstream forward: _UP4_TAAACTCTCCTGAGGATATC
References
Reviews
20735481,22092493
Original Publications
36815589,16091050,22773650,16357223,19389763,16030230,18567663,15066026,22496484,19389763,19749039,21278284,21602220,22329926,23190039,24386445,12864845,25538299,25843804,29311275,30263953,31769462,34487843,35595098,35638827,37577504,38141873

5D479874B43F521DB52EDC2C27CDE4967F22DE47

Page visits: 6133

Time of last update: 2025-10-27 03:34:41

Author of last update: Jstuelk