sftA

168

DNA translocase, translocation of non-segregated chromosomes prior to septum closure

Locus: BSU_29805

Molecular weight: 107.00 kDa

Isoelectric point: 5

Protein length: 952 aa

Gene length: 2859 bp

Function: resolution of chromosome dimers

Product: DNA translocase

Essential: no

Synonyms: sftA, ytpS, cdtA

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1674 (Galperin et al., 2021)

Gene

Coordinates: 3,049,725 → 3,052,583

The protein

Catalyzed reaction/ biological activity

• aids in moving DNA away from the closing septum, binds DNA, DNA-dependent ATPase activity PubMed
• translocation of non-segregated chromosomes prior to septum closure
• the two DNA translocases SftA and SpoIIIE synergistically affect chromosome dimer resolution presumably by positioning the dif sites in close proximity, before or after completion of cell division, respectively PubMed

Protein family

• FtsK/SpoIIIE/SftA family (with SpoIIIE, according to UniProt)

Domains

• FtsK domain (aa 622-813) (according to UniProt)

Structure

• 2IUT (PDB) (FtsK from Pseudomonas aeruginosa, partial, 48% identity, complex with SpoIIIE) PubMed
• C0SP86 (AlphaFold)

Paralogous protein(s)

• SpoIIIE

Localization

• peripheral membrane protein (via N-terminal amphipathic helix) PubMed
• recruitment to the Z-ring by SepF PubMed
• 30% of the molecules in the cytoplasm (Homogeneous) PubMed
• small fraction at the membrane PubMed
• 70% of the molecules are septum-bound, co-localizes with FtsZ at nascent division sites, recruitment to the septum depends on FtsA PubMed

Expression and Regulation

Operons

• Genes: sftA-murC

  Description: PubMed

Biological materials

Mutant

• MGNA-A438 (ytpS::erm), available at the NBRP B. subtilis, Japan
• 1A984 ( sftA::spec), PubMed, available at BGSC
• BKE29805 (''sftA::erm'', available in the BGSC, in Fabian Commichau's, and in Jörg Stülke's lab) PubMed
• BKE29805 (ΔsftA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAATTTATCTCTAACTCC,  downstream forward: _UP4_TAATATGGGTTCATTTTCAC
• BKK29805 (ΔsftA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAATTTATCTCTAACTCC,  downstream forward: _UP4_TAATATGGGTTCATTTTCAC

References

Reviews

Loading

Original Publications

Loading