flhA
168
part of the flagellar type III export apparatus (flagellar Type III secretion system), part of the CORE complex required for flagellum and nanotube assembly
locus
BSU_16390
Molecular weight
73.77 kDa
pI
4.64
function
flagellum and nanotube assembly
product
part of the type III CORE export apparatus
essential
no
synonyms
flhA
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG1298 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
1,707,714 1,709,747
Phenotypes of a mutant
no secretion of [protein|F03144BF8A187C8931938A21433431B8961E8EE7|flgM], permanent inhibition of [protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD] [Pubmed|25313396]
inactivation of ''[gene|974FA844E263AA694477992FA50468CB8EFAB807|flhA]'' confers resistance to high concentrations of Zn(II) [Pubmed|27935957]
deficient in both nanotube production and the associated intercellular molecular trafficking [pubmed|30929979]
defective in [category|SW.4.1.4|Swarming] motility [pubmed|35638827]
severe growth inhibition upon addition of subinhibitory concentrations of mirubactin C [pubmed|36312962]
The protein
Protein family
FHIPEP (flagella/HR/invasion proteins export pore) family (single member, according to UniProt)
Structure
[PDB|3MIX] (cytosolic domain) [Pubmed|20534509]
[AF|P35620]
[wiki|Localization]
cell membrane [Pubmed|20534509], 8 transmembrane helices [Pubmed|24064315]
Expression and Regulation
Operons
genes
[gene|E7D735A16C35FBC635CFDB92ECB1C84F442D0DF0|ylxF]-[gene|42277DE1030E6FEB416EAE381CD40A54D49736FF|fliK]-[gene|819FAE47ADC9A4FE55C8F2105E19FA7EE286FC0C|flgD]-[gene|DC906ED8D787602B5796BAD8FD81F02C4BAC8D13|flgE]-[gene|321BFB8FA97A749B1C569812A192EEE2AF348F97|swrD]-[gene|2CCB8AD9238D18BA2361020A671844C021E81EE0|fliL]-[gene|1D51AF3E6456F126203D7C7273FB828A47E26DFB|fliM]-[gene|2E73F8DD89F7CFCDE7FAFC58220D8171D0913BAC|fliY]-[gene|2F0495C7EAB81BDB1F3181677C555537BD2A972F|cheY]-[gene|C2C67880EDF09E1BA75A4791628EE1982F9B6B0B|fliO]-[gene|6ED6C3DDC4F3142FD01D32840D955B7E4A19F385|fliP]-[gene|A3C07B70C87D671979D053A6272A0FCDED6F3BB7|fliQ]-[gene|9856F25F23264AD1402A85AE9E25F10B68CAD739|fliR]-[gene|68DB2871A88535714C84FE86006AB54CEB6F0EAD|flhB]-[gene|974FA844E263AA694477992FA50468CB8EFAB807|flhA]-[gene|BB6F5D7463EF96E2C6344D0BC30A227C5E3B5817|flhF]-[gene|D6D34E68FB3BAAACB533F98290FD363A5B00B2C6|flhG]-[gene|B0415A8CD040EC714B54F4038E065B3E1E20A271|cheB]-[gene|6B3B222E56BF0C95A2371CA5208B5522B44D4689|cheA]-[gene|887D84520DF3D5F22DED525C1C17130EDE60DC36|cheW]-[gene|DC9B5446484E42F46EB2B0541192D7D8B4B3AC8F|cheC]-[gene|BE9373BEB682E5F8B0938AAA4ED9B723B357ABAE|cheD]-[gene|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]-[gene|347ACF1D4E2D0C1B4E9DF0DEA9807A6A7D1519AC|swrB]
description
[Pubmed|20233303]
regulation
see [wiki|fla-che operon]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: repression, in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: repression, in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
[protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|swrA]: activation, in [regulon|protein:5D479874B43F521DB52EDC2C27CDE4967F22DE47|swrA regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9657996], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]: sigma factor, [Pubmed|20233303], in [regulon|protein:7024E4162A6D827069F882FDEACA696EBC05DD40|sigD regulon]
genes
[gene|1C6C8DB02E10EAC0588389D9F0D3AF3E19172C5C|flgB]-[gene|CC423DE6481353699B0CD3A2B8BBC36967A832CC|flgC]-[gene|7E8F88F7A9CAD4ED0927CDC6AAFDEDC08197C709|fliE]-[gene|EB815705133E3318F655F6024B7D9BA587FD1DDA|fliF]-[gene|8DDCC3D139ACCB635BF014946E1282A72D535390|fliG]-[gene|4D8CF3BED8F94DE3F8FCDEB1FE55D5F1D17FE26F|fliH]-[gene|401459F105BC8A8342341D953AE259D6C3868AB6|fliI]-[gene|600DECF2BE9ADCAB87E53790CE4F0D61F8B3F7CC|fliJ]-[gene|E7D735A16C35FBC635CFDB92ECB1C84F442D0DF0|ylxF]-[gene|42277DE1030E6FEB416EAE381CD40A54D49736FF|fliK]-[gene|819FAE47ADC9A4FE55C8F2105E19FA7EE286FC0C|flgD]-[gene|DC906ED8D787602B5796BAD8FD81F02C4BAC8D13|flgE]-[gene|321BFB8FA97A749B1C569812A192EEE2AF348F97|swrD]-[gene|2CCB8AD9238D18BA2361020A671844C021E81EE0|fliL]-[gene|1D51AF3E6456F126203D7C7273FB828A47E26DFB|fliM]-[gene|2E73F8DD89F7CFCDE7FAFC58220D8171D0913BAC|fliY]-[gene|2F0495C7EAB81BDB1F3181677C555537BD2A972F|cheY]-[gene|C2C67880EDF09E1BA75A4791628EE1982F9B6B0B|fliO]-[gene|6ED6C3DDC4F3142FD01D32840D955B7E4A19F385|fliP]-[gene|A3C07B70C87D671979D053A6272A0FCDED6F3BB7|fliQ]-[gene|9856F25F23264AD1402A85AE9E25F10B68CAD739|fliR]-[gene|68DB2871A88535714C84FE86006AB54CEB6F0EAD|flhB]-[gene|974FA844E263AA694477992FA50468CB8EFAB807|flhA]-[gene|BB6F5D7463EF96E2C6344D0BC30A227C5E3B5817|flhF]-[gene|D6D34E68FB3BAAACB533F98290FD363A5B00B2C6|flhG]-[gene|B0415A8CD040EC714B54F4038E065B3E1E20A271|cheB]-[gene|6B3B222E56BF0C95A2371CA5208B5522B44D4689|cheA]-[gene|887D84520DF3D5F22DED525C1C17130EDE60DC36|cheW]-[gene|DC9B5446484E42F46EB2B0541192D7D8B4B3AC8F|cheC]-[gene|BE9373BEB682E5F8B0938AAA4ED9B723B357ABAE|cheD]-[gene|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]-[gene|347ACF1D4E2D0C1B4E9DF0DEA9807A6A7D1519AC|swrB]
description
[Pubmed|9657996,8157612,15175317]
regulation
expression during spore [wiki|germination] is strongly reduced under conditions of osmotic stress [Pubmed|27766092]
regulatory mechanism
[protein|2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A]: repression, in [regulon|protein:2C54FE2ADC82FF414D732018C90649D477A925AD|spo0A regulon]
[protein|5D479874B43F521DB52EDC2C27CDE4967F22DE47|swrA]: activation, in [regulon|protein:5D479874B43F521DB52EDC2C27CDE4967F22DE47|swrA regulon]
[protein|90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY]: repression, in [regulon|protein:90ACE0DECA58D3C1A55E135120F7A0C1C920571C|codY regulon]
[protein|D343D2096664A972026D911E7A17A35C7B1CD1C9|degU]: repression, in [regulon|protein:D343D2096664A972026D911E7A17A35C7B1CD1C9|degU regulon]
[protein|5A6FBAE6553343092862CB79E150F934978C32A9|sinR]: transcription elongation, binding of the [protein|search|SinR]-[protein|search|SlrR] heteromer to sites within [gene|search|fliE] and [gene|search|fliI] results in inhibition of transcription elongation [pubmed|40187681], in [regulon|protein:5A6FBAE6553343092862CB79E150F934978C32A9|sinR regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9657996], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
[protein|7024E4162A6D827069F882FDEACA696EBC05DD40|sigD]: sigma factor, [Pubmed|9657996], in [regulon|protein:7024E4162A6D827069F882FDEACA696EBC05DD40|sigD regulon]
Biological materials
Mutant
BKE16390 ([gene|974FA844E263AA694477992FA50468CB8EFAB807|flhA]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE16390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTGTTTTTTCTCTCCT, downstream forward: _UP4_AGCATTGGAGTGGTGGATAT
BKK16390 ([gene|974FA844E263AA694477992FA50468CB8EFAB807|flhA]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK16390 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATGCTGTTTTTTCTCTCCT, downstream forward: _UP4_AGCATTGGAGTGGTGGATAT
References
Reviews
Original Publications
Page visits: 5483
Time of last update: 2025-10-28 20:54:08
Author of last update: Jstuelk