hemZ
168
coproporphyrinogen III oxidase
locus
BSU_09840
Molecular weight
57.00 kDa
pI
5.899
function
heme biosynthesis
product
coproporphyrinogen III oxidase
essential
no
synonyms
hemZ, yhaW, yhaV
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG0635 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
1,057,680 1,059,185
The protein
Protein family
anaerobic coproporphyrinogen-III oxidase family (with [protein|757C51296E198849EAC1FFA4D37121D9085930A8|hemN], according to UniProt)
[wiki|Cofactors]
Fe-S cluster [pubmed|29292548]
Structure
[AF|Q796V8]
Paralogous protein(s)
[protein|757C51296E198849EAC1FFA4D37121D9085930A8|hemN]
Expression and Regulation
Operons
genes
[gene|5A1E474D2A6043ACF0DF00FEA7F66BFB1332C691|hemZ]
description
[Pubmed|10498703]
regulation
induced under anaerobic conditions during growth in the presence of nitrate (no induction in the absence of terminal electron acceptor) ([protein|search|Fnr], [protein|search|ResD], [protein|search|ArfM]) [Pubmed|10498703]
regulatory mechanism
[protein|B5EF521437323EF43F08E5EFDB5C798616CA499A|rex]: repression, in [regulon|protein:B5EF521437323EF43F08E5EFDB5C798616CA499A|rex regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|10498703], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Biological materials
Mutant
MGNA-B497 (yhaV::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1496 NBRP B. subtilis, Japan]
BKE09840 ([gene|5A1E474D2A6043ACF0DF00FEA7F66BFB1332C691|hemZ]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE09840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTTCATCACCTAATTTA, downstream forward: _UP4_CACTGATTACAGTGCTGCTT
BKK09840 ([gene|5A1E474D2A6043ACF0DF00FEA7F66BFB1332C691|hemZ]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK09840 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAACTTCATCACCTAATTTA, downstream forward: _UP4_CACTGATTACAGTGCTGCTT
References
Page visits: 3659
Time of last update: 2025-10-27 05:52:18
Author of last update: Melvin.boenninger