spsF

spsF
168

CMP-legionaminic acid synthase , transfer of legionaminic acid to the spore surface

locus
BSU_37860
Molecular weight
27.18 kDa
pI
5.51
Protein length
Gene length
function
spore crust polysaccharide synthesis
product
CMP-legionaminic acid synthase
essential
no
synonyms
spsF, ipa-68d

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG1861 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,887,026  3,887,748
Phenotypes of a mutant
the mutant tends to acquire suppressor mutations that result in improved growth [Pubmed|28189581]
less hydrophobic spore surface [pubmed|32817102]
The protein
Catalyzed reaction/ biological activity
required for spore crust assembly, transfer of legionaminic acid to the spore surface [pubmed|32817102]
Protein family
CMP-NeuNAc synthase family (single member, according to UniProt)
Structure
[AF|P39626]
Expression and Regulation
Operons
genes
[gene|219B0AAFB4ABB7E97A906553B73423F712505E27|spsA]-[gene|9E577B935FAB9605DAF83353E907A6561F11CAC1|spsB]-[gene|38DBA751456A0C0EC5D028939ADB8860ADA28F94|spsC]-[gene|2648D9E356683F5E9C00C40F0A6BBD1933322B09|spsD]-[gene|F27921CD9B89EB16AA57ACECEDBF21ED383629F0|spsE]-[gene|222F7086A214A427174E188CB1FEE4A8B98D303C|spsF]-[gene|9B34C9DBEC5B84A631CDFBEE8DF44384FF5C03B0|spsG]-[gene|8A80A058F270C134891CBCE7EBD8D7A23797F599|spsI]-[gene|90D505CAA4FAAEB6A6AF5C278E70DF714FACB4DA|spsJ]-[gene|4A4C5E6C1DFD46BC3CF9AEBA3FC1577767FF8465|spsK]-[gene|F87238E9B22F967370971ABA4F911EFAC4F559B5|spsL]
description
[Pubmed|9353933]
regulation
expressed during [wiki|sporulation] in the mother cell ([wiki|SigE], [protein|search|SigK], [protein|search|GerE]) [Pubmed|26577401,25239894,15383836]
regulatory mechanism
[protein|19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE]: activation, [Pubmed|25239894,15383836], in [regulon|protein:19228BAD44E6DA3DE908DC390FDF628C18D94E65|gerE regulon]
sigma factors
[protein|3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE]: sigma factor, [Pubmed|26577401], in [regulon|protein:3CB24D493B3282278B7DC61CE3C793DFA815F9E2|sigE regulon]
[protein|24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK]: sigma factor, [Pubmed|15383836], in [regulon|protein:24F7FD5C7C3A68BB2760ABB8CBD8FBD65E5FF7D4|sigK regulon]
additional information
the mRNA is very stable (half-life > 15 min) [http://www.ncbi.nlm.nih.gov/sites/entrez/12884008 PubMed]
Open in new tab

[gene|219B0AAFB4ABB7E97A906553B73423F712505E27|spsA]→[gene|F87238E9B22F967370971ABA4F911EFAC4F559B5|spsL]

2025-10-27 23:33:05

ghost

183

8fd40e70daa9bc3b7d469fa252e122a98e4555de

9FCD794B68194823BCA66D7E89CC93E5AF9CC0AA

Biological materials
Mutant
BKE37860 ([gene|222F7086A214A427174E188CB1FEE4A8B98D303C|spsF]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE37860 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCTTGCTTGAATGATAAAGA,  downstream forward: _UP4_ACCGAACGAGAGGCTGACTA
BKK37860 ([gene|222F7086A214A427174E188CB1FEE4A8B98D303C|spsF]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK37860 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_TCTTGCTTGAATGATAAAGA,  downstream forward: _UP4_ACCGAACGAGAGGCTGACTA
References
9353933,15383836,25239894,26577401,32817102

222F7086A214A427174E188CB1FEE4A8B98D303C

Page visits: 3562

Time of last update: 2025-10-28 06:14:31

Author of last update: Jstuelk