yqgA

168

unknown, genetically related to the cell wall-degrading dl-endopeptidases

Locus: BSU_25050

Molecular weight: 15.14 kDa

Isoelectric point: 10.23

Protein length: 142 aa

Gene length: 429 bp

Function: unknown

Product: unknown

Essential: no

E.C.: null

Synonyms: yqgA

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Groups of genes, Strongly expressed understudied proteins, Other highly expressed unknown proteins

Groups of genes, Membrane proteins

Groups of genes, Proteins of unknown function

List of homologs in different organisms

Gene

Coordinates: 2,587,996 → 2,588,424

The protein

Structure

P54484 (AlphaFold)

Localization

attached to the cell wall PubMed
localized at cell division sites during the transition period between the exponential and the stationary phases PubMed
cell wall(according to UniProt)

Expression and Regulation

Operons

Genes: yqgA

Description: PubMed

Biological materials

Mutant

MGNA-C487 (yqgA::erm), available at the NBRP B. subtilis, Japan
BKE25050 (ΔyqgA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTTGTAGATCCTCCTTT,  downstream forward: _UP4_TAACAGTTCAATAATGAGAA
BKK25050 (ΔyqgA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTTGTAGATCCTCCTTT,  downstream forward: _UP4_TAACAGTTCAATAATGAGAA

References

Reviews

Wicke D, Meißner J, Warneke R, Elfmann C, Stülke JUnderstudied proteins and understudied functions in the model bacterium Bacillus subtilis-A major challenge in current research.Molecular microbiology. 2023 Mar 7; . PMID: 36882621

Original Publications

Hashimoto M, Fujikura K, Miyake Y, Higashitsuji Y, Kiriyama Y, Tanaka T, Yamamoto H, Sekiguchi J A cell wall protein (YqgA) is genetically related to the cell wall-degrading dl-endopeptidases in Bacillus subtilis. Bioscience, biotechnology, and biochemistry. 2014; 78(8):1428-34. doi:10.1080/09168451.2014.923294. PMID:25130749
Nicolas P, Mäder U, Dervyn E, Rochat T, Leduc A, Pigeonneau N, Bidnenko E, Marchadier E, Hoebeke M, Aymerich S, Becher D, Bisicchia P, Botella E, Delumeau O, Doherty G, Denham EL, Fogg MJ, Fromion V, Goelzer A, Hansen A, Härtig E, Harwood CR, Homuth G, Jarmer H, Jules M, Klipp E, Le Chat L, Lecointe F, Lewis P, Liebermeister W, March A, Mars RA, Nannapaneni P, Noone D, Pohl S, Rinn B, Rügheimer F, Sappa PK, Samson F, Schaffer M, Schwikowski B, Steil L, Stülke J, Wiegert T, Devine KM, Wilkinson AJ, van Dijl JM, Hecker M, Völker U, Bessières P, Noirot P Condition-dependent transcriptome reveals high-level regulatory architecture in Bacillus subtilis. Science (New York, N.Y.). 2012 Mar 02; 335(6072):1103-6. doi:10.1126/science.1206848. PMID:22383849