flgC

168

flagellar basal-body rod protein, required for the assembly of the flagellar hook and filament

Locus: BSU_16190

Molecular weight: 16.12 kDa

Isoelectric point: 5.73

Protein length: 150 aa

Gene length: 453 bp

Function: movement and chemotaxis

Product: flagellar basal-body rod protein

Essential: no

Synonyms: flgC

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1558 (Galperin et al., 2021)

Gene

Coordinates: 1,691,667 → 1,692,119

Phenotypes of a mutant

• defective in swarming and flagellar assembly PubMed

The protein

Catalyzed reaction/ biological activity

• part of the flagellar rod-hook (in FliE-FlgB-FlgC-FlhO-FlhP-FlgE out, connection to Hag) PubMed

Protein family

• Flagella basal body rod proteins family (according to UniProt)

Structure

• P24501 (AlphaFold)

Localization

• bacterial flagellum basal body (according to Swiss-Prot),  extracellular (no signal peptide) PubMed

Expression and Regulation

Operons

• Genes: flgB-flgC-fliE-fliF-fliG-fliH-fliI-fliJ-ylxF-fliK-flgD-flgE-swrD-fliL-fliM-fliY-cheY-fliO-fliP-fliQ-fliR-flhB-flhA-flhF-flhG-cheB-cheA-cheW-cheC-cheD-sigD-swrB

  Description: PubMed

  Regulation

  • expression during spore germination is strongly reduced under conditions of osmotic stress PubMed

  Regulatory mechanism

  • Spo0A: repression, in spo0A regulon
  • SwrA: activation, in swrA regulon
  • CodY: repression, in codY regulon
  • DegU: repression, in degU regulon
  • SinR: transcription elongation, binding of the SinR-SlrR heteromer to sites within fliE and fliI results in inhibition of transcription elongation PubMed, in sinR regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon
  • SigD: sigma factor, PubMed, in sigD regulon

Biological materials

Mutant

• BKE16190 (ΔflgC::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_ATTTAAGCTATGAAAAGCTG,  downstream forward: _UP4_GAAATCGGAAAGTAGGTGAA
• BKK16190 (ΔflgC::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_ATTTAAGCTATGAAAAGCTG,  downstream forward: _UP4_GAAATCGGAAAGTAGGTGAA

References

Loading