icd

icd
168

[metabolite|isocitrate] dehydrogenase

locus
BSU_29130
Molecular weight
46.26 kDa
pI
4.83
Protein length
Gene length
function
TCA cycle
product
[metabolite|isocitrate] dehydrogenase
essential
no
ec
1.1.1.42
synonyms
icd, citC

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0538 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,979,716 2,980,987
Phenotypes of a mutant
reduced ability to sporulate [Pubmed|9244258]
growth and sporulation defects of the mutant could be partially bypassed by deletion of the major [metabolite|citrate] synthase gene (''[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]'') [Pubmed|10348849]
The protein
Catalyzed reaction/ biological activity
[metabolite|isocitrate] + NADP+ --> [metabolite|2-oxoglutarate] + CO2 + [metabolite|NADPH] (according to UniProt)
Protein family
Isocitrate and isopropylmalate dehydrogenases family (with [protein|105E3452D7F142A7D7616E35AF3FB753C9B63E38|leuB] and [protein|E9D1B04FCB24402B56DC6A6F7AD696209E4BD0FA|ycsA], according to UniProt)
[wiki|Cofactors]
Mg2+, Mn2+, NADP+
Structure
[PDB|1HQS] [pubmed|11290745]
[AF|P39126]
Modification
phosphorylated on Arg-180 [Pubmed|22517742]
phosphorylated [Pubmed|17726680], [Pubmed|16493705]
''in vitro'' phosphorylated by [protein|23FF4A00C36EC1B7297F51A9EF3579B41F0B7EBA|prkC] on Thr-138, Thr-147, and Thr-396 [Pubmed|20389117]
Effectors of protein activity
Inhibited by [metabolite|glyoxylate], [metabolite|oxaloacetate] and [metabolite|oxalomalate] [Pubmed|4147570]
Paralogous protein(s)
[protein|E9D1B04FCB24402B56DC6A6F7AD696209E4BD0FA|ycsA]
Additional information
This enzyme requires NADP+ exclusively. No activity was seen on the presence on NAD+ [Pubmed|4147570]
extensive information on the structure and enzymatic properties of Icd can be found at [http://www.proteopedia.org/wiki/index.php/Isocitrate_dehydrogenase Proteopedia]
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]
description
[Pubmed|8045899]
regulation
''[protein|search|citZ]'': catabolite repression ([protein|search|CcpA]) [Pubmed|12100558]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [protein|FE15A41A58A8177280817CA3825764C39185021A|ccpC]: transcription repression [Pubmed|12100558], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|FE15A41A58A8177280817CA3825764C39185021A|ccpC]: repression, (molecular inducer: citrate) [Pubmed|10656796], in [regulon|protein:FE15A41A58A8177280817CA3825764C39185021A|ccpC regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8045899], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]→[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]

2025-10-25 12:28:29

ghost

161

f9ad3d456cafa7c9074216bd662b61b54e3995fc

2BD9E142645FECA776F7762A7431A0FB5A5D9070

genes
[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]-[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]
description
[Pubmed|8045899]
regulation
''[protein|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]'': catabolite repression ([protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]) [Pubmed|12100558]
regulatory mechanism
[protein|E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA]: repression, [protein|FE15A41A58A8177280817CA3825764C39185021A|ccpC]: transcription repression [Pubmed|12100558], in [regulon|protein:E39AFEB7B7F28969A35C4B51CC6E7819F71C79D9|ccpA regulon]
[protein|FE15A41A58A8177280817CA3825764C39185021A|ccpC]: repression, (molecular inducer: citrate) [Pubmed|10656796], in [regulon|protein:FE15A41A58A8177280817CA3825764C39185021A|ccpC regulon]
[protein|E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB]: mRNA stability control, upon citrate accumulation or iron limitation [Pubmed|23354745], in [regulon|protein:E15E9F88B0E03FE8834C646369D2F4B4E713EF41|citB regulon]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|8045899], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Open in new tab

[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]→[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]

2025-10-21 00:36:58

Jstuelk

173

d65e97dee2d196244ee89dd42bbf730b7ea9c870

F01A9D3586F0AD300B6C4F086E56F8AEA52D457F

Biological materials
Mutant
GP666 (spc), GP672 (erm), available in [wiki|Jörg Stülke]'s lab
1A1000 ( ''icd''::''spec''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A1000&Search=1A1000 BGSC]
1A999 ( ''icd''::''spec''), [Pubmed| ], available at [http://pasture.asc.ohio-state.edu/BGSC/getdetail.cfm?bgscid=1A999&Search=1A999 BGSC]
GP790 (''[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]-[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]'')::''kan'', available in [wiki|Jörg Stülke]'s lab
GP2331 (''[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]-[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]'')::''kan'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'',available in [wiki|Jörg Stülke]'s lab
GP2333 (''[gene|58E3A065A95D03B4FB1F544906F53D1704D29EAD|citZ]-[gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]-[gene|5832127A2D0BD4AF2E891C93DC7C45221055FFC5|mdh]'')::''lox72'', Cre-recombinase is integrated in ''[gene|8C2DD87E0351BBEE0FD8C0462087CCAD7459AA88|sacA]'', available in [wiki|Jörg Stülke]'s lab
BKE29130 ([gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE29130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATAAAAACCTCCCAGT, downstream forward: _UP4_TAAGCAAGGAAAAAGCCTAA
BKK29130 ([gene|CB7D0E32C044D541CD966DC1F9DA489D518A7703|icd]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK29130 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACAATAAAAACCTCCCAGT, downstream forward: _UP4_TAAGCAAGGAAAAAGCCTAA
Expression vectors
pGP1121 (N-terminal Strep-tag, for [wiki|SPINE], purification from ''B. subtilis'', in [wiki|pGP380]) (available in [wiki|Jörg Stülke]'s lab) [pubmed|20933603]
two-hybrid system
''B. pertussis'' adenylate cyclase-based bacterial two hybrid system ([wiki|BACTH]), available in [wiki|Jörg Stülke]'s lab
Antibody
available in [wiki|Linc Sonenshein]'s lab
labs
[wiki| Linc Sonenshein], Tufts University, Boston, MA, USA [http://www.tufts.edu/sackler/microbiology/faculty/sonenshein/index.html Homepage]
References
36815589,10656796,12850135,11290745,10348849,11751849,18763711,17726680,16493705,4147570,20389117,9244258,20933603,22517742,24325460,24571712,15378759,24616559,29546354,38902266

CB7D0E32C044D541CD966DC1F9DA489D518A7703

Page visits: 10068

Time of last update: 2025-10-26 03:23:47

Author of last update: Jstuelk