rocB

168

N-carbamoyl-L-ornithine hydrolase, required for citrulline utilization

Locus: BSU_37770

Molecular weight: 64.74 kDa

Isoelectric point: 5.35

Protein length: 566 aa

Gene length: 1701 bp

Function: citrulline utilization

Product: N-carbamoyl-L-ornithine hydrolase

Essential: no

Synonyms: rocB, ipa-77d

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG4187 (Galperin et al., 2021)

Gene

Coordinates: 3,877,192 → 3,878,892

Phenotypes of a mutant

• unable to grow with citrulline as single source of nitrogen PubMed

The protein

Catalyzed reaction/ biological activity

• citrulline + H₂O + 2 H⁺ --> ornithine + carbamate (decays spontaneously to CO₂ and NH₄⁺) PubMed

Cofactors

• Mn²⁺ PubMed

Structure

• P39635 (AlphaFold)

Kinetic information

• K_M for citrulline: 7.35 mM PubMed
• v_max: 29.8 min^-1 PubMed

Paralogous protein(s)

• YqjN

Expression and Regulation

Operons

• Genes: rocA-rocB-rocC

  Description: PubMed

  Regulation

  • expression during spore germination is strongly reduced under conditions of osmotic stress PubMed
  • induced in the presence of arginine (AhrC) PubMed
  • induced in the presence of arginine, citrulline or ornithine (with ornithine as the molecular inducer) (RocR) PubMed

  Regulatory mechanism

  • CodY: repression, PubMed, in codY regulon
  • RocR: activation, PubMed, in rocR regulon
  • AhrC: activation, PubMed, in ahrC regulon
  • AbrB: repression, PubMed, in abrB regulon

  Sigma factors

  • SigL: sigma factor, PubMed, in sigL regulon

  Additional information

  • expression of the rocA-rocB-rocC operon is increased upon depletion of nusA (resulting from increased ahrC expression) Reference

Biological materials

Mutant

• BKE37770 (ΔrocB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAAATTGTCCTCCTGATC,  downstream forward: _UP4_AAAGAACCAAAGGGGGAAGG
• BKK37770 (ΔrocB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATAAATTGTCCTCCTGATC,  downstream forward: _UP4_AAAGAACCAAAGGGGGAAGG
• GP3713 (rocB::aphA3 trpC2) available in Jörg Stülke's lab
• GP3720 (rocB::cat trpC2) available in Jörg Stülke's lab PubMed
• GP3722 (rocB::tet trpC2) available in Jörg Stülke's lab PubMed

Expression vectors

• pGP3731: expression of His₆-rocB (gapA RBS) by pBQ200 in B. subtilis, available in Jörg Stülke's lab PubMed
• pGP3794: IPTG inducible expression, purification in E. coli with N-terminal Strep-tag, in pGP172, available in Jörg Stülke's lab PubMed
• pGP3781: expression of Strep-rocB by pGP380 in B. subtilis suitable for SPINE, available in Jörg Stülke's lab

References

Loading