pxpA

168

subunit of ATP-dependent 5-oxoprolinase

Locus: BSU_04050

Molecular weight: 27.39 kDa

Isoelectric point: 5.58

Protein length: 257 aa

Gene length: 774 bp

Function: detoxification of 5-oxoproline

Product: subunit of 5-oxoprolinase

Essential: no

Synonyms: pxpA, ycsF

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1540 (Galperin et al., 2021)

Gene

Coordinates: 457,023  457,796

Phenotypes of a mutant

• no growth with 5-oxoproline as single source of nitrogen PubMed
• reduced growth with ammonium as source of nitrogen due to the accumulation of toxic 5-oxoproline PubMed

The protein

Catalyzed reaction/ biological activity

• 5-oxoproline + ATP --> glutamate + ADP + P_i PubMed

Protein family

• LamB/PxpA family (single member, according to UniProt)

Structure

• 1V6T (PDB) (from Pyrococcus horikoshii, 52% identity)
• P42963 (AlphaFold)

Kinetic information

• K_m (5-oxoproline): 39 M PubMed

Expression and Regulation

Operons

• Genes: pxpA-ycsG-ycsI-pxpB-pxpC-kipR-lipC

  Description: PubMed

  Regulation

  • induced in the presence of 5-oxoproline PubMed

  Regulatory mechanism

  • KipR: repression, PubMed, in kipR regulon
  • TnrA: activation, PubMed, in tnrA regulon

Biological materials

Mutant

• MGNA-C072 (ycsF::erm), available at the NBRP B. subtilis, Japan
• BKE04050 (pxpA::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACAGAATCCCTCCTGCCAA,  downstream forward: _UP4_TCAACATAAAGGAGGAACAA
• BKK04050 (pxpA::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACAGAATCCCTCCTGCCAA,  downstream forward: _UP4_TCAACATAAAGGAGGAACAA

References

Loading