sndB

168

N-acetylcysteine deacetylase

Locus: BSU_39470

Molecular weight: 41.44 kDa

Isoelectric point: 5.32

Protein length: 380 aa

Gene length: 1143 bp

Function: utilization and detoxification of S-(2-succino)cysteine

Product: N-acetylcysteine deacetylase

Essential: no

Synonyms: sndB, yxeP

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1473 (Galperin et al., 2021)

Gene

Coordinates: 4,056,870 → 4,058,012

Phenotypes of a mutant

• a ''sndA sndB sndC'' triple mutant does not grow with N-acetyl cysteine and S-(2-succino)cysteine as the single sources of sulfur PubMed

The protein

Catalyzed reaction/ biological activity

• N-acetylcysteine + oxaloacetate --> cysteine + acetate PubMed

Protein family

• peptidase M20 family (according to UniProt)

Structure

• 1YSJ (PDB)
• P54955 (AlphaFold)

Paralogous protein(s)

• YkuR, SndA, AmhX
• SndC, (38,8%)

Expression and Regulation

Operons

• Genes: yxeK-snaB-yxeM-yxeN-yxeO-sndB-yxeQ

  Description: PubMed

  Regulation

  • repressed in the presence of cysteine (CymR) PubMed

  Regulatory mechanism

  • CymR: repression, PubMed, in cymR regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

  Additional information

  • the amount of the mRNA is substantially decreased upon depletion of RNase Y PubMed

Biological materials

Mutant

• MGNA-B712 (yxeP::erm), available at the NBRP B. subtilis, Japan
• BKE39470 (ΔsndB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_GTCGGCCATTGTTCTTCTCC,  downstream forward: _UP4_GTTATTGTATTGGAGACCAT
• BKK39470 (ΔsndB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_GTCGGCCATTGTTCTTCTCC,  downstream forward: _UP4_GTTATTGTATTGGAGACCAT

References

Loading