yfmT

168

vanillin dehydrogenase

Locus: BSU_07350

Molecular weight: 53.15 kDa

Isoelectric point: 5.08

Protein length: 485 aa

Gene length: 1458 bp

Function: unknown

Product: vanillin dehydrogenase

Essential: no

Synonyms: yfmT

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Groups of genes, Poorly characterized/ putative enzymes

List of homologs in different organisms, belongs to COG1012 (Galperin et al., 2021)

This gene is a member of the following regulons

SigD regulon

Gene

Coordinates: 807,091 → 808,548

The protein

Catalyzed reaction/ biological activity

oxidation of vanillin to vanillic acid PubMed
benzaldehyde + H₂O + NAD⁺ --> benzoate + 2 H⁺ + NADH (according to UniProt)
4-hydroxy-3-methoxybenzaldehyde + H₂O + NAD⁺ --> 4-hydroxy-3-methoxybenzoate + 2 H⁺ + NADH (according to UniProt)

Protein family

aldehyde dehydrogenase family (according to UniProt)

Structure

4DNG (PDB) (from Bacillus Subtilis, 47% identity)
3RHH (PDB) (from from Bacillus halodurans C-125 complexed with NADP, 32% identity, 67% similarity)
O06478 (AlphaFold)

Paralogous protein(s)

AldX, AldY, GbsA, YcbD, DhaS, IolA, YwdH, GabD, PutC, RocA

Expression and Regulation

Operons

Genes: yfmT-yfmS

Description: PubMed

Sigma factors

SigD: sigma factor, PubMed, in sigD regulon

Additional information

in minimal medium, YfmS is present with 4,200 +/- 800 molecules per cell PubMed

Biological materials

Mutant

MGNA-C232 (yfmT::erm), available at the NBRP B. subtilis, Japan
BKE07350 (ΔyfmT::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGGTCAGCATCTCCTTTA,  downstream forward: _UP4_TTCCCTTATTAATGAAAAGG
BKK07350 (ΔyfmT::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATGGTCAGCATCTCCTTTA,  downstream forward: _UP4_TTCCCTTATTAATGAAAAGG

Labs working on this gene/protein

Josef Altenbuchner

References

Loading