pucB

168

xanthine dehydrogenase

Locus: BSU_32500

Molecular weight: 20.91 kDa

Isoelectric point: 7.92

Protein length: 205 aa

Gene length: 618 bp

Function: purine utilization

Product: xanthine dehydrogenase

Essential: no

Synonyms: pucB, yurE

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG2068 (Galperin et al., 2021)

Gene

Coordinates: 3,339,331  3,339,948

The protein

Structure

• 2WAW (PDB) (from Mycobacterium tuberculosis, 27% identity)
• O32146 (AlphaFold)

Expression and Regulation

Operons

• Genes: pucA-pucB-pucC-pucD-pucE

  Description: PubMed

  Regulation

  • induced in the presence of purine nucleotides (effector: allantoin) (PucR) PubMed

  Regulatory mechanism

  • PucR: activation, PubMed, in pucR regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

• MGNA-A941 (yurE::erm), available at the NBRP B. subtilis, Japan
• BKE32500 (pucB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TCTCATACAACCGCCACCCG,  downstream forward: _UP4_TCTTGAACGGCCAAGTGACA
• BKK32500 (pucB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TCTCATACAACCGCCACCCG,  downstream forward: _UP4_TCTTGAACGGCCAAGTGACA

References

Yoshida K, Yamaguchi H, Kinehara M, Ohki YH, Nakaura Y, Fujita Y Identification of additional TnrA-regulated genes of Bacillus subtilis associated with a TnrA box. Molecular microbiology. 2003 Jul; 49(1):157-65. . PMID:12823818
Beier L, Nygaard P, Jarmer H, Saxild HH Transcription analysis of the Bacillus subtilis PucR regulon and identification of a cis-acting sequence required for PucR-regulated expression of genes involved in purine catabolism. Journal of bacteriology. 2002 Jun; 184(12):3232-41. . PMID:12029039
Schultz AC, Nygaard P, Saxild HH Functional analysis of 14 genes that constitute the purine catabolic pathway in Bacillus subtilis and evidence for a novel regulon controlled by the PucR transcription activator. Journal of bacteriology. 2001 Jun; 183(11):3293-302. . PMID:11344136