citZ

168

citrate synthase

Locus: BSU_29140

Molecular weight: 41.57 kDa

Isoelectric point: 5.45

Protein length: 372 aa

Gene length: 1119 bp

Function: TCA cycle

Product: citrate synthase II

Essential: no

E.C.: 2.3.3.1

Synonyms: citZ, citA2

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0372 (Galperin et al., 2021)

Gene

Coordinates: 2,981,151  2,982,269

Phenotypes of a mutant

• glutamate auxotrophy and a defect in sporulation PubMed

The protein

Catalyzed reaction/ biological activity

• acetyl-CoA + H₂O + oxaloacetate --> citrate + CoA + H⁺ (according to UniProt)

Protein family

• citrate synthase family (with MmgD and CitA, according to UniProt)

Structure

• 1IOM (PDB) (from Thermus thermophilus, 48& identity) PubMed
• 2C6X (PDB) (CitA, 42% identity)
• P39120 (AlphaFold)

Modification

• phosphorylation on Ser-284 PubMed

Effectors of protein activity

• Inhibited by acetyl-CoA, 2-oxoglutarate and NADH PubMed FEBS Letters
• Inhibited by citrate and CoA (competitively against acetyl-CoA and non-competitively against oxaloacetate) PubMed
• Inhibited by ATP competitively in B. subtilis strain 168 and HS 1A17 PubMed PubMed
• In B. subtilis strain HS 2A2, ATP inhibits a non-competitive fashion PubMed
• Activated by AMP PubMed

Paralogous protein(s)

• CitA, MmgD

Localization

• cytoplasm (homogeneously distributed throughout the cell) PubMed

Additional information

• CitZ is completely degraded in the forespore by ClpC-ClpP using MdfA as the adaptor protein PubMed
• extensive information on the structure and enzymatic properties of CitZ can be found at Proteopedia

Expression and Regulation

Operons

• Genes: citZ-icd-mdh

  Description: PubMed

  Regulation

  • ''CitZ'': catabolite repression (CcpA) PubMed

  Regulatory mechanism

  • CcpA: repression, CcpC: transcription repression PubMed, in ccpA regulon
  • CcpC: repression, (molecular inducer: citrate) PubMed, in ccpC regulon
  • CitB: mRNA stability control, upon citrate accumulation or iron limitation PubMed, in citB regulon

  Sigma factors

  • SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

• GP678 (erm), GP797 (spec) available in Jörg Stülke's lab
• 1A999 (citZ::spec), PubMed, available at BGSC
• GP790 Δ(''citZ-icd-mdh)::kan'', available in Jörg Stülke's lab
• GP797 (citZ::spec), allows expression of ''icd and mdh'', available in Jörg Stülke's lab
• GP1281 (citZ::erm), allows expression of ''icd and mdh'', available in Jörg Stülke's lab
• GP2331 Δ(''citZ-icd-mdh)::kan, Cre-recombinase is integrated in sacA'',available in Jörg Stülke's lab
• GP2333 Δ(''citZ-icd-mdh)::lox72, Cre-recombinase is integrated in sacA'', available in Jörg Stülke's lab
• BKE29140 (citZ::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATATAACATCTCCTTTT,  downstream forward: _UP4_TAAAGAACCATTGGAGGCTG
• BKK29140 (citZ::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATATAACATCTCCTTTT,  downstream forward: _UP4_TAAAGAACCATTGGAGGCTG

Expression vectors

• pGP1120 (N-terminal Strep-tag, for SPINE, purification from B. subtilis, in pGP380) (available in Jörg Stülke's lab) PubMed
• pGP1776 (for expression, purification in E. coli with N-terminal Strep-tag, in pGP172, available in Jörg Stülke's lab)
• pGP1761 (expression with N-terminal His-tag from E. coli, in pWH844), available in Jörg Stülke's lab
• pGP2515 (N-terminal Strep-tag, purification from E. coli, in pGP172), available in Jörg Stülke's lab
• pGP2261 (integration into ganA, expression under the control of the xylose-inducible PxylA promoter in B. subtilis, in pGP888), available in Jörg Stülke's lab

Two-hybrid system

• B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab

Antibody

• available in Linc Sonenshein's lab

Labs working on this gene/protein

• Linc Sonenshein, Tufts University, Boston, MA, USA Homepage
• Jörg Stülke, University of Göttingen, Germany Homepage

References

Reviews

Loading

Original Publications

Loading