katX

168

catalase, general stress protein

Locus: BSU_38630

Molecular weight: 62.19 kDa

Isoelectric point: 5.34

Protein length: 547 aa

Gene length: 1644 bp

Function: detoxification (degradation) of hydrogen peroxide

Product: catalase (major catalase in spores)

Essential: no

Synonyms: katX, yxlI

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Lifestyles, Sporulation, Sporulation proteins, Sporulation proteins/ other

Lifestyles, Coping with stress, General stress proteins (controlled by SigB)

Lifestyles, Coping with stress, Resistance against oxidative and electrophile stress

List of homologs in different organisms, belongs to COG0753 (Galperin et al., 2021)

This gene is a member of the following regulons

SigB regulon, SigF regulon, RsfA regulon

Gene

Coordinates: 3,964,997 → 3,966,640

The protein

Catalyzed reaction/ biological activity

2 H₂O₂ --> 2 H₂O + O₂ (according to UniProt)

Protein family

catalase family (according to UniProt)

Structure

4CAB (PDB) (from Deinococcus radiodurans, 69% identity) PubMed
P94377 (AlphaFold)

Paralogous protein(s)

KatA, KatE

Localization

cytoplasm (according to Swiss-Prot)

Expression and Regulation

Operons

Genes: katX

Description: PubMed

Regulation

expressed early during sporulation in the forespore (SigF, RsfA) PubMed

Regulatory mechanism

RsfA: activation, PubMed, in rsfA regulon

Sigma factors

SigB: sigma factor, PubMed, in sigB regulon
SigF: sigma factor, PubMed, in sigF regulon

Biological materials

Mutant

MGNA-B755 (katX::erm), available at the NBRP B. subtilis, Japan
BKE38630 (ΔkatX::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAATGGTTGGCCCTCCTTTT,  downstream forward: _UP4_TAACAACAGCGAACAGGGCT
BKK38630 (ΔkatX::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CAATGGTTGGCCCTCCTTTT,  downstream forward: _UP4_TAACAACAGCGAACAGGGCT

References

Loading