alsD

168

acetolactate decarboxylase

Locus: BSU_36000

Molecular weight: 28.65 kDa

Isoelectric point: 4.6

Protein length: 255 aa

Gene length: 768 bp

Function: overflow metabolism

Product: acetolactate decarboxylase

Essential: no

E.C.: 4.1.1.5

Synonyms: alsD

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Metabolism, Carbon metabolism, Carbon core metabolism, Overflow metabolism

Groups of genes, Phosphoproteins, Phosphorylation on either a Ser, Thr or Tyr residue

List of homologs in different organisms, belongs to COG3527 (Galperin et al., 2021)

Gene

Coordinates: 3,708,799  3,709,566

Phenotypes of a mutant

reduced acetoin production PubMed
impaired biofilm development PubMed

The protein

Catalyzed reaction/ biological activity

(2S)-2-acetolactate + H⁺ --> (R)-acetoin + CO₂ (according to UniProt)

Protein family

alpha-acetolactate decarboxylase family (single member, according to UniProt)

Structure

5XNE (PDB) PubMed
Q04777 (AlphaFold)

Modification

phosphorylated on ser/ thr/ tyr PubMed, in vitro phosphorylated by PrkC on Ser-88 PubMed

Expression and Regulation

Operons

Genes: alsS-alsD

Description: PubMed

Regulation

induction by acetate (AlsR) PubMed
expression is heterogeneous PubMed

Regulatory mechanism

AlsR: activation, in the presence of acetate PubMed, in alsR regulon
Rex: repression, if the ratio NADH2/NAD is high PubMed, in rex regulon
stringent response: positive regulation, due to presence of adenines at +1 and +2 positions of the transcript PubMed, in stringent response

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

BKE36000 (alsD::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATTTCCCTTCACTCCTT,  downstream forward: _UP4_TAAAAGAAAAAAAGAAAGCC
BKK36000 (alsD::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATATTTCCCTTCACTCCTT,  downstream forward: _UP4_TAAAAGAAAAAAAGAAAGCC

Expression vectors

for expression, purification in E. coli with N-terminal Strep-tag, in pGP172: pGP822, available in Jörg Stülke's lab, PubMed

References

Loading