rpsA

168

ribosomal protein S1, contributes to mRNA delivery to the ribosome by RNA polymerase

Locus: BSU_22880

Molecular weight: 42.24 kDa

Isoelectric point: 4.57

Protein length: 382 aa

Gene length: 1149 bp

Function: translation

Product: ribosomal protein S1

Essential: no

Synonyms: ypfD, jofD

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG0539 (Galperin et al., 2021)

Gene

Coordinates: 2,394,664 2,395,812

The protein

Catalyzed reaction/ biological activity

• contributes to mRNA delivery to the ribosome by RNA polymerase bioRxiv

Protein family

• bacterial ribosomal protein bS1 family (single member, according to UniProt)

Domains

• 4 reiterated S1 domains (aa 16-84, aa 102-167, aa 188-256, aa 273-342) (according to UniProt)

Structure

• 6BU8 (PDB) (E. coli protein, 39% identity) PubMed
• 5X8R (PDB) (chloroplast, small ribosomal subunit, 37% identity to aa 14 .. 266) PubMed
• 1SRO (PDB) (E. coli S1 RNA-binding domain, 37% identity to aa 185 ... 343) PubMed
• P38494 (AlphaFold)

Modification

• phosphorylation on Ser-243 PubMed

Localization

• cytoplasm, region surrounding the nucleoid PubMed

Additional information

• belongs to the 100 most abundant proteins PubMed

Expression and Regulation

Operons

• Genes: cmk-rpsA

  Description: PubMed

• Genes: cmk-rpsA-fni

  Description: PubMed

• Genes: rpsA-fni

  Description: PubMed

• Genes: rpsA

  Description: PubMed

• Genes: motI-ypfB-cmk-rpsA-fni

  Description: PubMed

• Genes: motI-ypfB-cmk-rpsA

  Description: PubMed

Additional information

• expression is reduced in motile cells as compared to non-motile cells PubMed

Biological materials

Mutant

• BKE22880 (rpsA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTGAATAACCTCCTTGG, downstream forward: _UP4_TAATTGGTGATAAACGTGAC
• BKK22880 (rpsA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATTTGAATAACCTCCTTGG, downstream forward: _UP4_TAATTGGTGATAAACGTGAC

References

Loading