psdB

168

ABC transporter (permease) for the export of lipid II-binding lantibiotics, such as nisin and gallidermin

Locus: BSU_34690

Molecular weight: 73.22 kDa

Isoelectric point: 9.8

Protein length: 646 aa

Gene length: 1941 bp

Function: export of toxic peptides

Product: ABC transporter (permease)

Essential: no

Synonyms: psdB, yvcS

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Transporters, ABC transporters, Exporters, Export of peptides

Lifestyles, Coping with stress, Resistance against toxins/ antibiotics

Groups of genes, Membrane proteins

List of homologs in different organisms, belongs to COG0577 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, PsdR regulon

Gene

Coordinates: 3,563,581  3,565,521

The protein

Protein family

ABC-4 integral membrane protein family (according to UniProt)

Structure

O06981 (AlphaFold)

Paralogous protein(s)

YxdM

Localization

cell membrane (according to UniProt)

Expression and Regulation

Operons

Genes: psdR-psdS-psdA-psdB

Description: PubMed

Regulation

''psdA'': induced by nisin, gallidermin (PsdR) PubMed

Regulatory mechanism

PsdR: activation, PubMed, in psdR regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Genes: psdA-psdB

Description: PubMed

Regulation

''psdA'': induced by nisin, gallidermin (PsdR) PubMed

Biological materials

Mutant

MGNA-B634 (yvcS::erm), available at the NBRP B. subtilis, Japan
BKE34690 (psdB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CCGTTGCAGATTCCCAAGAA,  downstream forward: _UP4_TAATATGAAATCCGGTCTGT
BKK34690 (psdB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CCGTTGCAGATTCCCAAGAA,  downstream forward: _UP4_TAATATGAAATCCGGTCTGT

References

Reviews

George NL, Bennett EC, Orlando BJGuarding the walls: the multifaceted roles of Bce modules in cell envelope stress sensing and antimicrobial resistance.Journal of bacteriology. 2024 Jun 13; :e0012324. PMID: 38869304

Original Publications

Mahendran A, Orlando BJGenome wide structural prediction of ABC transporter systems in Bacillus subtilis.Frontiers in microbiology. 2024; 15:1469915. PMID: 39397791
Coumes-Florens S, Brochier-Armanet C, Guiseppi A, Denizot F, Foglino M A new highly conserved antibiotic sensing/resistance pathway in firmicutes involves an ABC transporter interplaying with a signal transduction system. PloS one. 2011 Jan 19; 6(1):e15951. doi:10.1371/journal.pone.0015951. PMID:21283517
Rietkötter E, Hoyer D, Mascher T Bacitracin sensing in Bacillus subtilis. Molecular microbiology. 2008 May; 68(3):768-85. doi:10.1111/j.1365-2958.2008.06194.x. PMID:18394148
Quentin Y, Fichant G, Denizot F Inventory, assembly and analysis of Bacillus subtilis ABC transport systems. Journal of molecular biology. 1999 Apr 02; 287(3):467-84. . PMID:10092453