bsaA

bsaA
168

similar to glutathione peroxidase

locus
BSU_21900
Molecular weight
18.11 kDa
pI
5.25
Protein length
Gene length
function
unknown
product
unknown
essential
no
synonyms
bsaA

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG0386 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
2,304,553  2,305,035
The protein
Protein family
glutathione peroxidase family (single member, according to UniProt)
Structure
[PDB|2WGR] (Schistosoma mansoni phospholipid glutathione peroxidase, 49% identity) [pubmed|19714775]
[AF|P52035]
Additional information
The gene is annotated in KEGG as glutathione peroxidase EC 1.11.1.9. It is marked in Swiss-Prot as glutathione peroxidase homolog and in MetaCyc as glutathione peroxidase. Several studies suggested that glutathione is probably absent in ''B. subtilis''.   [Pubmed|19935659]
Expression and Regulation
Operons
genes
[gene|9929712AC9E5581DD0EF3213CC49A0E6C8D3087D|bsaA]-[gene|A0CC440185318F7F8665AF7A8279C79A09E35518|ypgQ]-[gene|B42367583867799BD88D737C848E16B9143C5957|ypgR]
description
[Pubmed|22383849]
Open in new tab

[gene|9929712AC9E5581DD0EF3213CC49A0E6C8D3087D|bsaA]→[gene|B42367583867799BD88D737C848E16B9143C5957|ypgR]

2025-10-24 05:44:28

Jstuelk

140

1d79d5fd4885ca13584ac99df3cef44e13bb1bb7

729D24A44397A06B5787BA6BECC4548D5C6AB3FB

Biological materials
Mutant
MGNA-A887 (bsaA::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/887 NBRP B. subtilis, Japan]
BKE21900 ([gene|9929712AC9E5581DD0EF3213CC49A0E6C8D3087D|bsaA]::erm  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE21900 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTAAGTCCCTCCTATGT,  downstream forward: _UP4_GAGCAATAAAAAGAGGGTGT
BKK21900 ([gene|9929712AC9E5581DD0EF3213CC49A0E6C8D3087D|bsaA]::kan  trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK21900 BGSC],  [Pubmed|28189581], upstream reverse: _UP1_CATGTAAGTCCCTCCTATGT,  downstream forward: _UP4_GAGCAATAAAAAGAGGGTGT
References
8969496,19935659,19714775

9929712AC9E5581DD0EF3213CC49A0E6C8D3087D

Page visits: 3203

Time of last update: 2025-10-24 08:14:38

Author of last update: Melvin.boenninger