yetI

168

split paralog of RsbR with YezB

Locus: BSU_07170

Protein length: 192 aa

Gene length: 576 bp

Function: possible stressosome protein

Product: split paralog of RsbR with YezB

Essential: no

Synonyms: yetI

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Information processing, Regulation of gene expression, Sigma factors and their control, Control of sigma factors

Groups of genes, Pseudogenes

Gene

Coordinates: 786,689 → 787,264

Expression and Regulation

Operons

Genes: yetI-yezB

Description: PubMed

Biological materials

Mutant

MGNA-B460 (yetI::erm), available at the NBRP B. subtilis, Japan
BKE07170 (ΔyetI::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACGGTCTGTCTCCTTTTTC,  downstream forward: _UP4_ATTGATACAAAACGGCACAG
BKK07170 (ΔyetI::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CACGGTCTGTCTCCTTTTTC,  downstream forward: _UP4_ATTGATACAAAACGGCACAG