cwlT

168

cell wall hydrolase, required for conjugation of ICEBs1, part of the type IV secretion system for DNA transfer , C-terminal domain hydrolyzes bond between D-Glu and m-DAP

Locus: BSU_04970

Molecular weight: 36.39 kDa

Isoelectric point: 8.63

Protein length: 329 aa

Gene length: 990 bp

Function: conjugative transfer of ICEBs1

Product: cell wall hydrolase

Synonyms: cwlT, yddH

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Cellular processes, Cell envelope and cell division, Cell wall degradation/ turnover, Autolysis

Prophages and mobile genetic elements, Mobile genetic elements, ICEBs1

List of homologs in different organisms, belongs to COG0791 (Galperin et al., 2021)

Gene

Coordinates: 544,022  545,011

The protein

Catalyzed reaction/ biological activity

hydrolysis of peptidoglycan (linkage between N-acetylmuramic acid and N-acetylglucosamine and bond between D--glutamate and  meso-diaminopimelic acid) PubMed
degradation of gamma-polyglutamic acid PubMed

Protein family

Peptidase C40 family (according to UniProt)

Domains

N-terminal domain is an N-acetylmuramidase that cleaves the linkage between N-acetylmuramic acid and N-acetylglucosamine PubMed
C-terminal D,L-endopeptidase domain (NlpC/P60 domain) PubMed, cleaves the bond between D--glutamate and  meso-diaminopimelic acid PubMed

Structure

4FDY (PDB) (from Staphylococcus aureus, 42% identity) PubMed
P96645 (AlphaFold)

Effectors of protein activity

both enzymatic activities are inhibited by interaction with IseA PubMed

Localization

secreted (with signal peptide) PubMed
may be a lipoprotein, but the lipid anchor is not required for function PubMed

Expression and Regulation

Operons

Genes: xis-ydzL-devI-ydcP-ydcQ-nicK-S172-ramS-ramT-ramA-conB-conC-conD-conE-yddF-conG-cwlT-yddI-yddJ

Description: PubMed

Regulatory mechanism

ImmR: repression, PubMed, in immR regulon

Biological materials

Mutant

BKE04970 (cwlT::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TATCATCTTGTTCTTTCATC,  downstream forward: _UP4_ATTAAATAACTAGGAGTGAA
BKK04970 (cwlT::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_TATCATCTTGTTCTTTCATC,  downstream forward: _UP4_ATTAAATAACTAGGAGTGAA

References

Loading