htpG
168
class III heat-shock protein (molecular chaperone)
locus
BSU_39820
Molecular weight
72.08 kDa
pI
4.67
function
chaperone
product
class III heat-shock protein (molecular chaperone)
essential
no
synonyms
htpG
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG0326 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
4,089,429 4,091,309
The protein
Protein family
heat shock protein 90 family (single member, according to UniProt)
Structure
[PDB|2IOQ] (from ''Escherichia coli'', 39% identity, 61% similarity) [Pubmed|17055434]
[AF|P46208]
[wiki|Localization]
cytoplasm (according to Swiss-Prot)
Expression and Regulation
Operons
genes
[gene|962A955DED82EC0197757206A706796EC8F768BD|htpG]
description
[Pubmed|9150201]
regulation
induced by high temperature [Pubmed|9150201]
sigma factors
[protein|360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA]: sigma factor, [Pubmed|9150201], in [regulon|protein:360F48D576DE950DF79C1A2677B7A35A8D8CC30C|sigA regulon]
Biological materials
Mutant
GP1159 (del cat) available in [wiki|Jörg Stülke]'s lab
BKE39820 ([gene|962A955DED82EC0197757206A706796EC8F768BD|htpG]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE39820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCTTGATCGCTCCTTTA, downstream forward: _UP4_TAAACAGAAAAAGGAATCGT
BKK39820 ([gene|962A955DED82EC0197757206A706796EC8F768BD|htpG]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK39820 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CACTCTTGATCGCTCCTTTA, downstream forward: _UP4_TAAACAGAAAAAGGAATCGT
References
Reviews
Original Publications
Page visits: 4905
Time of last update: 2025-10-27 03:25:56
Author of last update: Jstuelk