lipA
168
lipoyl synthase, trigger enzyme
locus
BSU_32330
Molecular weight
33.77 kDa
pI
8.25
function
synthesis of lipoic acid
product
lipoyl synthase,trigger enzyme
essential
no
ec
2.8.1.8
synonyms
lipA, yutB
Outlinks
Genomic Context
Categories containing this gene/protein
List of homologs in different organisms, belongs to COG0320 (Galperin et al., 2021)
This gene is a member of the following regulons
Gene
Coordinates
3,320,324 3,321,220
Phenotypes of a mutant
reduced transformation efficiency [Pubmed|19028902]
strong inhibition of growth on minimal media [Pubmed|19820084]
The protein
Catalyzed reaction/ biological activity
[[Fe-S] cluster scaffold protein carrying a second [4Fe-4S]2+ cluster] + 4 H+ + N6-octanoyl-L-lysyl-[protein] + 2 oxidized [2Fe-2S]-[ferredoxin] + 2 S-adenosyl-L-methionine --> (R)-N6-dihydrolipoyl-L-lysyl-[protein] + 2 5'-deoxyadenosine + [[Fe-S] cluster scaffold protein] + 4 Fe3+ + 2 hydrogen sulfide + 2 L-methionine + 2 reduced [2Fe-2S]-[ferredoxin] (according to UniProt)
required for ''[gene|788725411B2E741103603373E43441FD036E1BA0|comEA]'' transcription [Pubmed|19028902]
Protein family
[wiki|Radical SAM superfamily] (according to UniProt)
[wiki|Cofactors]
Fe-S cluster [pubmed|29292548]
Structure
[PDB|4U0O] (from ''Thermosynechococcus elongatus'', 48% identity) [Pubmed|25100160]
[AF|O32129]
Expression and Regulation
Operons
genes
[gene|2EC820F54911603A99444DC922E41C60AA526EB2|lipA]
description
[pubmed|22383849]
Biological materials
Mutant
MGNA-B578 (yutB::erm), available at the [https://shigen.nig.ac.jp/bsub/resource/strainGeneDisrupted/detail/1577 NBRP B. subtilis, Japan]
BKE32330 ([gene|2EC820F54911603A99444DC922E41C60AA526EB2|lipA]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE32330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTCCCATCATCTCCAAT, downstream forward: _UP4_TAATGCCAAAACGCCAGATC
BKK32330 ([gene|2EC820F54911603A99444DC922E41C60AA526EB2|lipA]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK32330 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CAATTCCCATCATCTCCAAT, downstream forward: _UP4_TAATGCCAAAACGCCAGATC
References
Reviews
Original Publications
Page visits: 5523
Time of last update: 2025-10-26 01:51:02
Author of last update: Jstuelk