parB

168

CTP hydrolase, chromosome positioning near the pole and transport through the polar septum / antagonist of SMC complex to the origin of replication, coordination of early steps in DNA replication with establishment of a medial division site

Locus: BSU_40960

Molecular weight: 32.06 kDa

Isoelectric point: 8.42

Protein length: 282 aa

Gene length: 849 bp

Function: chromosome positioning before asymmetric septation

Product: Smc-loading protein

Essential: no

Synonyms: parB, spo0J, spo0JB

Genomic Context

Hide small RNAsZoom:

List of homologs in different organisms, belongs to COG1475 (Galperin et al., 2021)

Gene

Coordinates: 4,205,556 → 4,206,404

Phenotypes of a mutant

• a whiA parB double mutant is not viable, this can be suppressed by inactivation of yneA PubMed

The protein

Catalyzed reaction/ biological activity

• CTP + H₂O —> CDP - H⁺ + phosphate PubMed
• forms DNA bridging interactions around parS to condense DNA and earmark the bacterial chromosome for segregation PubMed
• inhibits ParA dimerization and concomitant DNA-binding activity by stimulating ParA ATPase activity PubMed
• recruits the condensin complex to the DNA origin region PubMed
• the dimer binds specifcally to the centromere-like parS sequence PubMed
• prevents Z ring assembly over the bacterial nucleoid and helps fine tune the assembly of the Z ring at midcell during the cell cycle PubMed

Protein family

• ParB family (with Noc, according to UniProt)

Domains

• N-terminal domain (NTD, aa 1 - 96): binds CTP and ParA PubMed
• Central DNA-binding domain (CDBD, aa 102 - 216): binds parS DNA PubMed
• C-terminal domain (CTD, aa 233 - 282): binding of non-specific DNA, dimerization, essential for DNA condensation PubMed

Structure

• 4UMK (PDB) (complex with parS DNA)
• 5U1G (PDB) PubMed
• 5U1J (PDB) PubMed
• 6SDK (PDB) (complex with CDP)
• P26497 (AlphaFold)

Effectors of protein activity

• binding of CTP stimulates the specific interaction with the parS DNA PubMed
• hydrolysis of CTP is essential for DNA condensation PubMed
• CTP promotes the formation of condensates by a low amount of ParB at parS sites PubMed

Paralogous protein(s)

• Noc

Localization

• chromosome centromer PubMed

Expression and Regulation

Operons

• Genes: parA-parB

  Description: PubMed

  Regulation

  • repressed under conditions that trigger sporulation (Spo0A) PubMed

  Regulatory mechanism

  • Spo0A: repression, PubMed, in spo0A regulon

Biological materials

Mutant

• 1S135 ( spo0J::spec), PubMed, available at BGSC
• 1S136 ( spo0J::spec), PubMed, available at BGSC
• 1S137 ( spo0J::spec), PubMed, available at BGSC
• BKE40960 (ΔparB::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CGCATTAATCCCTTTTCCAA,  downstream forward: _UP4_TAAATGAAAAAACCATCTTT
• BKK40960 (ΔparB::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CGCATTAATCCCTTTTCCAA,  downstream forward: _UP4_TAAATGAAAAAACCATCTTT

Labs working on this gene/protein

• Heath Murray, Centre for Bacterial Cell Biology, Newcastle, UK homepage

References

Reviews

Loading

Original Publications

Loading