aroA

aroA
168

3-deoxy-D-arabino-heptulosonate 7-phosphate synthase / chorismate mutase-isozyme 3

locus
BSU_29750
Molecular weight
39.38 kDa
pI
5.34
Protein length
Gene length
function
biosynthesis of aromatic amino acids
product
3-deoxy-D-arabino-heptulosonate 7-phosphate synthase /
essential
no
ec
2.5.1.54
synonyms
aroA, aroG

Genomic Context

Categories containing this gene/protein

List of homologs in different organisms, belongs to COG2876 (Galperin et al., 2021)

This gene is a member of the following regulons

Gene
Coordinates
3,045,445 3,046,521
The protein
Catalyzed reaction/ biological activity
D-erythrose 4-phosphate + H2O + phosphoenolpyruvate --> 7-phospho-2-dehydro-3-deoxy-D-arabino-heptonate + phosphate (according to UniProt)
chorismate --> prephenate (according to UniProt)
Protein family
class-I DAHP synthase family (single member, according to UniProt)
[wiki|Domains]
Chorismate mutase domain (aa 1-90) (according to UniProt)
Structure
[PDB|1VR6] (from ''Thermotoga maritima'', 51% identity, 68% similarity)
[PDB|5GO2] (chorismate mutase-like domain, with citrate) [pubmed|28743924]
[AF|P39912]
Modification
phosphorylation on Ser-2 [Pubmed|17218307]
phosphorylation on Thr-4 [Pubmed|17726680]
phosphorylated on Arg-45 and Arg-301 [Pubmed|22517742]
Cys126 is S-bacillithiolated by NaOCl stress in B. subtilis and other Bacillus species [Pubmed|22938038]
Effectors of protein activity
subject to feedback inhibition [Pubmed|19258532]
Additional information
belongs to the 100 most abundant proteins [PubMed|15378759]
Expression and Regulation
Operons
genes
[gene|75E331ABCDE1C60AAB4AC01229CED81B0AF50E1C|aroA]
description
[Pubmed|9387221]
Open in new tab

[gene|75E331ABCDE1C60AAB4AC01229CED81B0AF50E1C|aroA]

2025-10-23 14:54:10

ghost

113

87ef7376a3fd4442d768a3a2fbe85729e8570134

E34FF0014B03F671CED03422AD84D4FD91310A77

Biological materials
Mutant
BKE29750 ([gene|75E331ABCDE1C60AAB4AC01229CED81B0AF50E1C|aroA]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE29750 BGSC] and in [wiki|Jrg Stlke]'s lab, [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTTCATCCTTTCCC, downstream forward: _UP4_TAATTGAACAATCCAAAAGG
BKK29750 ([gene|75E331ABCDE1C60AAB4AC01229CED81B0AF50E1C|aroA]::kan trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKK29750 BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATTTTTTTCATCCTTTCCC, downstream forward: _UP4_TAATTGAACAATCCAAAAGG
References
22938038,9387221,19258532,17726680,17218307,22517742,15378759,28743924,35643569

75E331ABCDE1C60AAB4AC01229CED81B0AF50E1C

Page visits: 8299

Time of last update: 2025-10-26 06:28:36

Author of last update: Jstuelk