ytpQ

168

putative alternative coproporphyrinogen III oxidase

Locus: BSU_29830

Molecular weight: 30.89 kDa

Isoelectric point: 5.3

Protein length: 269 aa

Gene length: 810 bp

Function: biosynthesis of heme b under anaerobic conditions

Product: putative alternative coproporphyrinogen III oxidase

Essential: no

E.C.: null

Synonyms: ytpQ

Genomic Context

Hide small RNAsZoom:

Categories containing this gene/protein

Metabolism, Additional metabolic pathways, Biosynthesis of cofactors, Biosynthesis of heme/ siroheme

Lifestyles, Coping with stress, Resistance against oxidative and electrophile stress

List of homologs in different organisms, belongs to COG4848 (Galperin et al., 2021)

This gene is a member of the following regulons

SigA regulon, Spx regulon

Gene

Coordinates: 3,053,364  3,054,173

Phenotypes of a mutant

derepression of the Fur and PerR regulons PubMed
elevated oxidative protein damage upon exposure of the cells to methylglyoxal PubMed
the ''spx ytpQ'' doulbe mutant shows reduced growth in minimal medium and hypersensitivity to methylglyoxal PubMed

The protein

Catalyzed reaction/ biological activity

coproporphyrinogen III --> coproporphyrin III PubMed

Protein family

UPF0354 family (single member, according to UniProt)

Structure

O34496 (AlphaFold)

Expression and Regulation

Operons

Genes: ytpP-ytpQ-ytpR

Description: PubMed

Regulatory mechanism

Spx: activation, PubMed, in spx regulon

Sigma factors

SigA: sigma factor, PubMed, in sigA regulon

Biological materials

Mutant

MGNA-A437 (ytpQ::erm), available at the NBRP B. subtilis, Japan
BKE29830 (ytpQ::erm  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTTCAAACCGATGTCCT,  downstream forward: _UP4_AAGGATTAGAAAGGATTTTT
BKK29830 (ytpQ::kan  trpC2) available at BGSC,  PubMed, upstream reverse: _UP1_CATTTTCAAACCGATGTCCT,  downstream forward: _UP4_AAGGATTAGAAAGGATTTTT

References

Loading